We narrowed to 10,398 results for: SEC
-
Plasmid#83565PurposeExpresses a mCitrine-mCerulean FRET sensor containing the catalytic domain of PKCalpha and a short peptide substrate derived from the pseudosubstrate of PKCalpha.DepositorInsertPKC alpha (PRKCA Human)
Tags10 nm ER/K Helix, FLAG Purificaiton Tag, Tev Prot…ExpressionBacterial and InsectMutationOnly catalytic domain of PKC (aa 335-672)PromoterT7 PromoterAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-hDcr-K70A.
Plasmid#89145PurposeExpression of helicase mutant of human Dicer in Sf9 cellsDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIMCyp (owl monkey)(K283D, Q287D)
Plasmid#79036PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5Cyp (owl monkey) (K283D, Q287D)
TagsOneSTrEP-FLAGExpressionInsectMutationChanged Lys 283 to Asp and Gln 287 to AspPromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-ZKSCAN1 548-1047
Plasmid#69886PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in DrosophilaDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1/CALR ins5-His
Plasmid#214796PurposeBaculovirus expression of human CALR ins5DepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A-mTLR4ecd-VLR
Plasmid#187877PurposeBaculovirus protein expression of mouse TLR4 (residues 26–544) fused with hagfish variable lymphocyte receptor (VLR) (residues 126–200)DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only