173,455 results

#243748

PVC cargo/regulatory region - deleted toxin cargos (Pdp1/Pnf) - vegfa sgRNA - Cre loaded into the PVC tube via Pdp1 (NTD)

Feng Zhang

Kreitz et al Nat Biotechnol. 2025 Aug 12. doi: 10.103

Sept. 24, 2025

Academic Institutions and Nonprofits only

#51585

expresses RNAi-resistant (RNAiR) myc-tagged mouse Rem2 (long version)

Suzanne Paradis

Ghiretti et al Dev Neurobiol. 2011 May;71(5):374-89. do

April 7, 2014

Academic Institutions and Nonprofits only

#236078

SB13 transposase, for use with Sleeping Beauty transponson plasmids

Masashi Narita

Chan et al Nature. 2024 Sep;633(8030):678-685. doi:

April 16, 2025

Academic Institutions and Nonprofits only

#136038

G3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#52083

Lentiviral expression vector for TAZ with N-terminal FLAG and His tags

Yutaka Hata

Yang et al Mol Cell Biol. 2014 Feb 18.

April 22, 2014

Academic Institutions and Nonprofits only

#239405

Expresses phb2-mScarlet3-H in mammalian cells

Zhifei Fu

Xiong et al Nat Methods. 2025 Apr 17. doi: 10.1038/s

Aug. 4, 2025

Academic Institutions and Nonprofits only

#145962

Bacterial Expression of Dmp68

Elisa Izaurralde

Feb. 25, 2022

Academic Institutions and Nonprofits only

#196048

Encodes a G alpha subunit (GNAl1) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteins

Justin English

Olsen et al Nat Chem Biol. 2020 May 4. pii: 10.1038/

March 15, 2023

Academic Institutions and Nonprofits only

#187273

Lentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758K

Alpha Yap

Budnar et al Dev Cell. 2019 Jun 17;49(6):894-906.e12.

Sept. 26, 2022

Academic Institutions and Nonprofits only