We narrowed to 27,217 results for: gfp
-
Plasmid#65264Purposesynchronize trafficking of ST from the ER (RUSH system)DepositorInsertStr-KDEL and truncated sialyltransferase (ST6GAL1 Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationcontains only amino acids 1 to 43 of STPromoterCMVAvailable SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Chronos-GFP
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUbC-nls-ha-stdMCP-stdGFP
Plasmid#98916Purposesynonymized tandem dimer MCP fused to synonymized tandem dimer GFPDepositorInsertstdMCP-stdGFP
UseLentiviralTagsGFPPromoterUbCAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGG-cTP-TurboID-GFP
Plasmid#209403PurposeTransiently expressing and visualizing the subcellular localization of TurboID fused with a chloroplast transit peptide (cTP) in plantaDepositorInsertPM-3XHA-TurbOID
TagsGFPExpressionPlantPromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable SinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVT_Dn29-dCas9-P2A-GFP
Plasmid#247165PurposeIn vitro transcription of human codon optimized fusion of Dn29-dCas9-P2A-GFPDepositorInsertDn29-dCas9-P2A-GFP
UseIn vitro transcriptionTagsSV40 NLSPromotermutated T7Available SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-opEBNA2-IRES-GFP
Plasmid#220354PurposeExpresses EBV latent gene EBNA2 in mammalian cells (EBNA2 coding sequence was optimised for expression and carries a C-terminal 3xHA-tag)DepositorInsertopEBNA2 (EBNA-2 Epstein-Barr Virus (EBV) strain B95-8)
UseRetroviralTags3 x HA tagExpressionMammalianMutationcodon-optimised for expression in mammalian cellsAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 N-term GFP tTA
Plasmid#107551PurposeAll-in-one dox-repressible expression of cDNA with optional N-term GFP tag.DepositorTypeEmpty backboneUseLentiviralTagsGFP (optional)ExpressionMammalianAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC407 - pAAV EF1a eGFP
Plasmid#60058PurposeAn AAV packaging vector that expresses enhanced green fluorescent protein under control of the EF1a promoter.DepositorInsertenhanced Green Fluorescent Protein
UseAAVExpressionMammalianPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
[#GS24 -LV] Syn1-GFP-OMP25
Plasmid#233566PurposeLentiviral construct of mitochondrial localized GFP to be expressed in the donor cells under the Synapsin1 promotorDepositorInserteGFP (eGFP Synthetic, Aequorea victoria)
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only