We narrowed to 7,325 results for: 11
-
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-ires-Luc
Plasmid#63576PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional cDNA and Luc expression upon integration. The vector contains an FRT site and two mut loxP sites.DepositorInsertStop-Lox71-IRES-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionExpressionMammalianPromoterCAGAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFPV25-cR-2iG
Plasmid#204618PurposeFluorescent reporter for SPI2 induction in SalmonellaDepositorInsertsrpsM promoter
sseA promoter
TagsGFP and dsRedExpressionBacterialAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight A173
Plasmid#53615PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-A173
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-RHOA
Plasmid#183836PurposeRepair template for the N-terminal tagging of RhoA with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertRHOA homology arms with mNeonGreen-linker (RHOA Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-UAP56
Plasmid#157661PurposeExpresses UAP56 in E.coli cellDepositorInsertSpliceosome RNA helicase DDX39B (DDX39B Human)
TagsGST tagExpressionBacterialMutationdeleted amino acids 1-43Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSNRK
Plasmid#138694PurposeExpresses a human SNRK-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDRIVE-CAG-hFX-HA
Plasmid#14994DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1 UBXN2A
Plasmid#113505PurposeBacterial expression of GST-tagged UBXN2ADepositorAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.H1-NP
Plasmid#134367PurposeNanoluc complementation assay. Expression of histamine receptor H1 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of the Flag epitope at N terminus of H1 receptor.DepositorInsertH1-NP (HRH1 Human)
TagsFlag and natural peptide of nanoluciferaseExpressionBacterial and MammalianPromoterT7Available SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-TEV-U1AF37MF77M
Plasmid#168267PurposeExpresses human dmU1A with the F37M/F77M double mutantDepositorInsertU1A RRM1 crystallization module (SNRPA Human)
Tags6xHis tag N-terminus, TEV protease cleavage siteExpressionBacterialMutationchanged F37M and F77MPromoterT7 promotorAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-GRAB_eCB2.0
Plasmid#164608PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in CaMKII positive neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterCaMKIIAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1
Plasmid#83569PurposeExpresses TET1 with a mutated catalytic domain in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianMutationcatalytic domain mutant H1672D, D1674APromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab7a-7
Plasmid#56443PurposeLocalization: Ras GTPase, Excitation: 488, Emission: 507DepositorInsertRab7a (RAB7A Human)
TagsEGFPExpressionMammalianMutationN117S in NM_004637.5PromoterCMVAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
FH1-MGT#2-mCherry_PGK-H2B-CFP
Plasmid#164102PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 U6-SaDMDR7-U6-SaDMDL2
Plasmid#78603PurposeAAV vector containing gRNAs (for SaCas9) targeting Dmd introns 22 and 23DepositorInsertU6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
H2B-mAvicFP1
Plasmid#129511PurposeExpresses H2B-mAvicFP1 in mammalian cells (human histone 2B)DepositorInsertH2B-mAvicFP1
ExpressionMammalianMutationmAvicFP1 fused to the C terminus of human histone…PromoterCMVAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb2
Plasmid#162794PurposeCcnb2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNCST-mAvicFP1
Plasmid#129509PurposeExpresses mAvicFP1 constitutively in E. coli (most strains)DepositorInsertmAvicFP1
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMX-PL1-WDR5
Plasmid#59970PurposeMammalian Expression of WDR5DepositorAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
P119 C-Check
Plasmid#66817PurposeDual-fluorescent surrogate reporter vector for in vitro functional assay of programable DNA nuclease and enrichment of genetically edited cellsDepositorInserttruncated Enhanced Green Fluorescent Protein and asRED
ExpressionMammalianPromoterPGK and CMVAvailable SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-DICER-Prom
Plasmid#25851DepositorAvailable SinceAug. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-ACTB
Plasmid#183868PurposeRepair template for the N-terminal tagging of beta-actin with mRuby2 in human cells using CRISPR/Cas9.DepositorInsertACTB homology arms with mRuby2-linker (ACTB Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgTom
Plasmid#138661PurposeExpresses a Tomato-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgTomato
UseLentiviralPromoterhU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-GP-2-ATRX ADD
Plasmid#59698PurposeContains histone modification interacting domain (ATRX ADD)DepositorAvailable SinceOct. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1-WDR5
Plasmid#59969PurposeBacterial Expression GST-WDR5DepositorAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Plasmid#78606PurposepZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2DepositorInsertCMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoter173CMV, U6Available SinceDec. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-EXO1b D173A
Plasmid#68269PurposeBacterial expression of human EXO1 D173A (catalytically-dead) mutantDepositorInsertEXO1 (EXO1 Human)
TagsMxe intein/chitin binding domainExpressionBacterialMutationcatalytically-dead D173A. Please see depositor co…PromoterT7Available SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CB7.CI.ACY1-flag.WPRE.rBG
Plasmid#132686PurposeAAV plasmid encoding mouse ACY1 with C-terminal flag tagDepositorAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGW011b Dual AAV vector pAAV-EFS-dCAS9-spA
Plasmid#192160PurposeDual AAV vector AAV-dCas9DepositorInsertDead Cas9
UseAAVMutationNAAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSICO-CPSF6-358-eGFP
Plasmid#110693PurposeExpresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with eGFPDepositorInsertCPSF6-eGFP (CPSF6 )
UseLentiviralTagsEGFPMutationTruncation of CPSF6 isoform 2 at amino acid 358Available SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-Tol2
Plasmid#113384Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseTol2 reporterAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFL His-SDS22 / PP1gamma
Plasmid#113511PurposeExpression of His-SDS22 / PP1gamma dimer in insect cells (Baculovirus system)DepositorAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBJG1 T7-8xHis-OGT D554N
Plasmid#154279PurposeBacterial expression of full length human OGT with D554N mutation (Cleavage, no Ser/Thr glycosylation). N-terminal T7_leader-8xHis tag followed by HRV3C protease site.DepositorInsertO-GlcNAc Transferase (OGT Human)
Tags8x His, HRV3C protease site, and T7 leaderExpressionBacterialMutationAspartate 554 changed to Asparagine- bacterial co…Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAC-TMPRSS4
Plasmid#172422PurposeMAC-tagged gene expressionDepositorInsertTransmembrane protease serine 4 (TMPRSS4 Human)
TagsMAC-tagExpressionMammalianPromoterCMV promoterAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
KAT6B-luciferase
Plasmid#113353Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseLuciferaseAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFL His-mEos3.2-I3
Plasmid#113516PurposeExpression of His-Eos-I3 in insect cells (Baculovirus system)DepositorAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTYF-PRSx8-AstR-p2A-GFP
Plasmid#159632PurposeLentiviral expression of the Allatostatin receptor, P2A GFP under the PRSx8 promoterDepositorAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1 p37
Plasmid#113500PurposeBacterial expression of GST-tagged p37DepositorAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
FH1-PNGT#2-mCherry
Plasmid#164099PurposeFluorescent reporter for genetic tracing of proneural Glioblastoma cell-state.DepositorInsertPNGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFIa-DIO-LMO7 (mNeonGreen-eKL9h-VChR1)
Plasmid#205098PurposeCre-dependent fusion protein of mNeonGreen, eKL9h, and Volvox channelrhodopsin-1 (luminopsin LMO7) for bioluminescent optogeneticsDepositorInsertmNeonGreen, eKL9h, and Volvox channelrhodopsin-1
UseAAVPromoterhSynAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ECT2
Plasmid#183835PurposeRepair template for the N-terminal tagging of Ect2 with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertECT2 homology arms with mNeonGreen-linker (ECT2 Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only