We narrowed to 1,982 results for: rpe
-
Plasmid#219430PurposeTranscriptional unit (MoClo-position 2): 2x35Ss_Omega enhancer_PapE-4LF2-N-SpCas9i-N_tOCSDepositorInsertLB_2x35Ss-omega enhancer:PapE-4xLF2-NLS-SpCas9i-NLS:tOCS_RB (Position 2)
UseCRISPR; Moclo compatible level 1 module (position…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[CoChR-GFP]
Plasmid#62724PurposeAAV-mediated expression of CoChR-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertCoChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR
Plasmid#111502PurposeExpresses a zinc finger specific to the human VEGFA locus, which is linked to a VPR transcriptional activation domain via a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].DepositorInsertZF(VEGFA)-StaPL(AI)-YFP-VPR
ExpressionMammalianMutationThe HCV NS3 protease carries V36M, T54A, and S122…PromoterCMVAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLPX-rc [Chronos-GFP]
Plasmid#122102PurposeAAV-mediated expression of Chronos-GFP under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [Chronos-tdTomato]
Plasmid#105834PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChronos-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-PSMB5-PSMB6-PSMB7
Plasmid#217898PurposeInsect cell expression of human 20S CP proteasome subunit beta type-5 (PSMB5), beta type-6 (PSMB6), and beta type-7 (PSMB7)DepositorAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-MOSPD2 W201E
Plasmid#186471PurposeExpression of human MOSPD2 (mutant W201E, unable to bind lipid droplets) fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationW201E (no more binding to lipid droplets)Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-HSF1-VIRF2
Plasmid#218557PurposeEncodes SFFV promoter-driven MCP-HSF1-VIRF2 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-HSF1-VIRF2
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_1k)-PGKpuro2ABFP-W
Plasmid#208418PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC3_2b)-PGKpuro2ABFP-W
Plasmid#208419PurposeLentiviral gRNA plasmid targeting human BIRC3 gene, co-expression of BFP tagDepositorInsertBIRC3 (BIRC3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCASP8_1k)-PGKpuro2ABFP-W
Plasmid#208422PurposeLentiviral gRNA plasmid targeting human CASP8 gene, co-expression of BFP tagDepositorInsertCASP8 (CASP8 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCASP8_2b)-PGKpuro2ABFP-W
Plasmid#208423PurposeLentiviral gRNA plasmid targeting human CASP8 gene, co-expression of BFP tagDepositorInsertCASP8 (CASP8 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hTNF_2b)-PGKpuro2ABFP-W
Plasmid#208426PurposeLentiviral gRNA plasmid targeting human TNF gene, co-expression of BFP tagDepositorInsertTNF (TNF Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_1k)-PGKpuro2ABFP-W
Plasmid#208412PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMAP3K7_2m)-PGKpuro2ABFP-W
Plasmid#208413PurposeLentiviral gRNA plasmid targeting human MAP3K7 gene, co-expression of BFP tagDepositorInsertMAP3K7 (MAP3K7 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pb-NES-ZapCV5 (cpV143)
Plasmid#112061PurposeGenetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Low affinity to free zinc (Kd ~ 300nM, n = 0.55) due to mutation of the zinc binding Cys residues to His.DepositorInsertNES-ZapCV5
TagsNuclear Export Signal (NES) derived from HIV-1ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…PromoterCBAAvailable SinceJuly 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
FLAG-JAK1
Plasmid#174572PurposeHuman FLAG-tagged JAK1 expression (N-term. tag) (CMV prom.)DepositorAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only