We narrowed to 7,680 results for: CCH
-
Plasmid#226889Purpose6xHis-PSP-GS-PANN(75-150)-(5aaGS)-Msp1(36-362)DepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only
-
-
-
-
pAM102
Plasmid#226694Purpose6xHis-Sumo-Ub-Ub-Ub-UbDepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM034_P7_3"Lys3
Plasmid#216459Purpose3' homology arm for S. pombe genomic integration. Part type 7 following the YeastToolkit MoClo grammar.DepositorInsert3''lys3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41K-TDH3pr-mNeon
Plasmid#194534PurposeLow copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42K-TDH3pr-mNeon
Plasmid#194535PurposeHigh copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41N-TDH3pr-mNeon
Plasmid#194536PurposeLow copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N-TDH3pr-mNeon
Plasmid#194537PurposeHigh copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41H-TDH3pr-mNeon
Plasmid#194538PurposeLow copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM038_P8b_5'Lys3
Plasmid#216463Purpose5' homology arm for S. pombe genomic integration. Part type 8b following the YeastToolkit MoClo grammar.DepositorInsert5'lys3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBSsgRNA
Plasmid#224867PurposeYeast genome editing, Insertion of 20 bp oligo into sgRNA geneDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB170
Plasmid#218591PurposeExpress engineered TFs Adr1c(S230A), Pip2c, and Oaf1cDepositorInsertAdr1
ExpressionYeastMutationAdr1(S230A), Pip2(1-168 + 2,497-2,988), Oaf1(1-30…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1340
Plasmid#218593PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22. Also overexpresses Pex11DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM284
Plasmid#226122PurposeExpression of cdc48 E588QDepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAM289
Plasmid#226126PurposeExpression of Npl4 D460K/Y461ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
paM291
Plasmid#226128PurposeExpression of His6-GST-3C-Npl4 T255A/T571ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM288
Plasmid#226125PurposeExpression of Npl4 W252A/R253EDepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM285
Plasmid#226123PurposeExpression of cdc48 W561A/Y562ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL194
Plasmid#222225PurposeExpresses site 1/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 1/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL195
Plasmid#222226PurposeExpresses site 2/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 2/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL368
Plasmid#222227PurposeExpresses site 3/Cas9/Eco1 RT in HIS3 locus.DepositorInsertsite 3/Cas9/Eco1 RT
UseCRISPRExpressionYeastAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pPOM040_P8b_5'Ura4
Plasmid#216461Purpose5' homology arm for S. pombe genomic integration. Part type 8b following the YeastToolkit MoClo grammar.DepositorInsert5'ura4
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM036_P7_3"Ura4
Plasmid#216465Purpose3' homology arm for S. pombe genomic integration. Part type 7 following the YeastToolkit MoClo grammar.DepositorInsert3''ura4
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM024_P2_pMPA1
Plasmid#216449PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter mpa1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM022_P2_pRPS1002
Plasmid#216447PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter rps1002
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM020_P2_pTRS1
Plasmid#216445PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter trs1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM014_P2_pGPM1
Plasmid#216439PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter gpm1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceMay 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM032_P4_tSynth30
Plasmid#216457PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth30
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM031_P4_tSynth29
Plasmid#216456PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth29
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM030_P4_tSynth27
Plasmid#216455PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth27
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM029_P4_tSynth25
Plasmid#216454PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth25
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM028_P4_tSynth3
Plasmid#216453PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator synth3
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM027_P4_tSynthGuo
Plasmid#216452PurposeSynthetic terminator for gene expression in yeasts and fungi. Part type 4 following the YeastToolkit MoClo grammar.DepositorInsertTerminator guo
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM025_P2_pTUP11
Plasmid#216450PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tup11
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM023_P2_pAPL4
Plasmid#216448PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter apl4
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPOM021_P2_pTUB1
Plasmid#216446PurposeConstitutive promoter for gene expression in S. pombe. Part type 2 following the YeastToolkit MoClo grammar.DepositorInsertPromoter tub1
UseSynthetic BiologyExpressionYeastMutationRemoval of any BsaI // BsmBI restriction siteAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only