We narrowed to 2,325 results for: PUC19
-
Plasmid#218288PurposeIntroduction of a cyanamide-inducible I-SceI expression cassette, use in combination with pITEdv1DepositorInsertHO(-253, -1)-tSynth3UseTagsExpressionYeastMutationPromoterAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only
-
ATP1A1_T804N_hPGK1_mScarlet-I-TOSI_Donor
Plasmid#173208PurposeHDR donor plasmid to introduce the T804N mutation conferring cellular resistance to ouabain and the mScarlet-I mTOR signaling indicator (TOSI) cassette to ATP1A1 intron 17.DepositorInsertATP1A1-T804N mScarlet-I-TOSI donor
UseCRISPRTagsExpressionMammalianMutationPromoterhPGK1Available sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPAP_scFv
Plasmid#183733PurposeExpresses anti-lysozyme scFv antibodyDepositorInsertAnti-lysozyme scFv
UseTagsHis6-tagExpressionYeastMutationPromoterAOX1 promoterAvailable sinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD424
Plasmid#178202PurposeExpression of Rok from the hns promoterDepositorInsertphns + rok
UseTagsExpressionBacterialMutationPromoterhns promoterAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD410
Plasmid#178200PurposeExpression of sRok from the hns promoterDepositorInsertphns + srok
UseTagsExpressionBacterialMutationPromoterhns promoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIALD2HMGr
Plasmid#185867PurposeKnocking out ALD6; expressing acetylating aldehyde dehydrogenase (Lactobacillus reuteri pduP and L. reuteri EutE) and an NADH-preferring HMG-CoA reductase (Delftia acidovorans mvaA) in S. cerevisiaeDepositorInsertALD6(-125, 40)> PSk.GAL1>Da.mvaA>TPGK1-PADH1> Lr.pduP> TPDC1-PGAL2>Lr.EutE-ALD6(1054, 1749)
UseTagsExpressionYeastMutationNonePromoterAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15541_dCBE-SuperFi-Cas9
Plasmid#184371PurposeMammalian expression of nuclease inactive SuperFi-Cas9 CBE base editorDepositorInsertdCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15543_dABE-SuperFi-Cas9
Plasmid#184373PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE7 base editorDepositorInsertdABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15545_dABE8e-SuperFi-Cas9
Plasmid#184375PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE8e base editorDepositorInsertdABE8e-SuperFi-Cas9
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EBFP_Nick_Dual_sgRNA
Plasmid#178094PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and EBFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EBFP nick sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_EGFP_Nick_Dual_sgRNA
Plasmid#178095PurposeControl vector for coselection for PE3b in human cells. Tandem expression of ATP1A1 G3 and EGFP Nick sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + EGFP nick sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178096PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDY153: Flag(SUZ12) WT HDR plasmid
Plasmid#170793PurposeWT homology directed repair plasmid for performing genome-editing on the SUZ12 LocusDepositorInsertSUZ12 (SUZ12 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
PW124-LMNA 5'HA-TriTag (mCherry)-3'HA (HDR donor)
Plasmid#164047PurposeCRISPR donor plasmid to insert TriTag (mCherry) into the N-terminus of human LMNA geneDepositorInsertmCherry-TriTag
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJBL714
Plasmid#140384PurposeExpresses CtcS-regulated 3WJdB RNA aptamer driven by T7 promoter with the ctcO sequence 5BP downstream from the promoterDepositorInsertT7-ctcO-3WJdB-T
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only