We narrowed to 13,202 results for: BASE

#156471

Bacterial expression of Sars-CoV2 Nsp3c_SUD-C protein with His-tag and GST-tag

Ylva Ivarsson

Mihalic et al Nat Commun. 2023 Sep 13;14(1):5636. doi:

Aug. 4, 2020

Academic Institutions and Nonprofits only

#156473

Bacterial expression of Sars-CoV2 Nsp3e_NAB protein with His-tag and GST-tag

Ylva Ivarsson

Mihalic et al Nat Commun. 2023 Sep 13;14(1):5636. doi:

Aug. 4, 2020

Academic Institutions and Nonprofits only

#113701

Dox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Feb. 14, 2019

Academic Institutions and Nonprofits only

#113696

U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Feb. 14, 2019

Academic Institutions and Nonprofits only

#113695

U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Jan. 2, 2019

Academic Institutions and Nonprofits only

#113699

Dox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Dec. 11, 2018

Academic Institutions and Nonprofits only

#87390

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87388

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87389

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87393

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only