We narrowed to 25,236 results for: FER
-
Plasmid#140099PurposeCRISPR-Cas9 library validation (positive control)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMutationPromotergRNA1 under U6 and gRNA2 under H1Available sinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm1
Plasmid#20878DepositorInsertp21 3'UTR site 1 mutation (Cdkn1a Mouse)
UseLuciferaseTagsExpressionMammalianMutationPredicted miRNA binding site 1 (Position ~420) GC…PromoterAvailable sinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-c
Plasmid#53078Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-BAX-201
Plasmid#117332PurposeDual luciferase assay for miRNA-targeted UTRDepositorInsert3' UTR BAX-201
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterMurine PGK-1Available sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-GFP-RELA K5R
Plasmid#196631PurposeExpress GFP-RELA K5RDepositorInsertGFP-RELA K5R (RELA Human)
UseLentiviralTagsGFPExpressionMutationK122R, K123R, K310R, K314R, K315RPromoterAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-244
Plasmid#90502PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - IRES - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm2
Plasmid#20879DepositorInsertp21 3'UTR site 2 mutation (Cdkn1a Mouse)
UseLuciferaseTagsExpressionMammalianMutationPredicted miRNA binding site 2 (Position ~1100) G…PromoterAvailable sinceMarch 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPKm-112
Plasmid#90494PurposepcDNA3 - pCMV - MTAD - PIF3, expresses Phytochrome interacting factor 3 (PIF3) and minimal transactivation domain (MTAD), under CMV promoterDepositorInsertMTAD-PIF3
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-R03
Plasmid#46567PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (random mutagenesis of CMVwt 3' end).DepositorInsertCMV mutant promoter
UseSynthetic BiologyTagsExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …PromoterAvailable sinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-161K enhancer-ETS-CORE-MUT-minP:fLuc-TK:rLuc
Plasmid#138367PurposeLentiviral plasmid contains 161k modified human enhancer with with ETS binding sites mutated driving firefly Luciferase 2 and Renilla Luciferase driven by TK promoterDepositorInsert161K human enhancer, with ETS binding sites mutated, driving firefly enhancer and TK driving refills luciferase
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CMVwt
Plasmid#46559PurposeMammalian expression plasmid with EGFP expressed from CMV wild-type promoter.DepositorInsertCMV wt promoter
UseSynthetic BiologyTagsExpressionMammalianMutationOur version has a G at base 724 (reference has C)PromoterCMVAvailable sinceSept. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-R05
Plasmid#46568PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (random mutagenesis of CMVwt 3' end).DepositorInsertCMV mutant promoter
UseSynthetic BiologyTagsExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …PromoterAvailable sinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
p3E-DysF
Plasmid#109544PurposeMultisite gateway vector for 3' tagging with DysferlinDepositorInsertDysferlin (dysf Zebrafish)
UseZebrafish plasmidsTagsExpressionMutationPlease see Depositor CommentsPromoterAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-161K enhancer-NR2F2-MUT-minP:fLuc-TK:rLuc
Plasmid#138368PurposeLentiviral plasmid contains 161k modified human enhancer with with NR2F2 binding sites mutated driving firefly Luciferase 2 and Renilla Luciferase driven by TK promoterDepositorInsert161K human enhancer, with NR2F2 binding sites mutated, driving firefly enhancer and TK driving renilla luciferase
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-A
Plasmid#64513PurposeAS-30D hepatoma hexokinase II 4.3 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseExpressionMutationIsolated from AS-30D rat hepatomaPromoterHexokinase IIAvailable sinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-C02
Plasmid#46563PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (CMVwt CAAT box mutant).DepositorInsertCMV mutant promoter
UseSynthetic BiologyTagsExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …PromoterAvailable sinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCOCK CM-C18
Plasmid#46560PurposeMammalian expression plasmid with EGFP expressed from synthetic promoter (CMVwt CAAT box mutant).DepositorInsertCMV mutant promoter
UseSynthetic BiologyTagsExpressionMammalianMutationMutant version of CMV promoter (refer to Table 1 …PromoterAvailable sinceSept. 20, 2013AvailabilityAcademic Institutions and Nonprofits only