We narrowed to 4,427 results for: Alk
-
Plasmid#164102PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherTagsExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-STING-C1471S-FLAG
Plasmid#198188PurposeMammalian expression of FLAG-tagged mouse STING1 C1471SDepositorInsertTMEM173 (Sting1 Mouse)
UseTagsFLAGExpressionMammalianMutationThe cysteine in STING at position 147 mutates to …PromoterCMVAvailable sinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HRV-B14_3C
Plasmid#203466PurposeExpresses HRV-B14 3C protease from a GAL10 promoter with a URA3 markerDepositorInsertHRV-B14 3C protease (HRVBgp1 )
UseTagsExpressionYeastMutationPromoterGAL10Available sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNK3203
Plasmid#219749PurposeDVK_AF CIDAR vector encoding hispidin-synthase from Mycena citricolor under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - mcitHispS - tSV40
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
ACVR1-TAAS-R206H
Plasmid#206184Purposein vitro transcription of RNA encoding human ACVR1 with mutations S190A, S192A, and R206HDepositorInsertactivin A receptor type 1 (ACVR1 Human)
UseIn vitro transcriptionTagsFLAG tagExpressionMutationS190A, S192A, R206HPromoterAvailable sinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-STING-C64S,C65S-FLAG
Plasmid#198186PurposeMammalian expression of FLAG-tagged mouse STING1 C64S, C65SDepositorInsertTMEM173 (Sting1 Mouse)
UseTagsFLAGExpressionMammalianMutationThe cysteine in STING at position 64/65 mutates t…PromoterCMVAvailable sinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW2614_pCAG-PV1-GAI-L2-28-396-FlpO-ABI-NLS-BGHpA
Plasmid#108833PurposeExpresses aa28 to aa396 of Flp recombinase fused to GAI and ABI CIDsDepositorInsertFlp recombinase fragment aa28 to aa396
UseCre/Lox and Synthetic BiologyTagsABI,NLS and GAIExpressionMammalianMutationPromoterpCAGAvailable sinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EMCV_3C
Plasmid#201941PurposeExpresses EMCV 3C protease from a GAL promoter with a URA3 markerDepositorInsertEMCV 3C protease (EMCVgp1 )
UseTagsExpressionYeastMutationPromoterGAL1Available sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
nSaCas9 I744 miniABEMax V82G
Plasmid#135379PurposeExpression of nSaCas9 intradomain insertion of single evolved TadA monomer (V82G) at the specified position (I744 )DepositorInsertnSaCas9 I744 miniABEMax V82G
UseCRISPRTagsExpressionMammalianMutation(V82G)PromoterAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-KUNV_NS2B-GS-NS3
Plasmid#203506PurposeExpresses KUNV NS2B-NS3 protease (with GS linker) from a GAL promoter with a URA3 markerDepositorInsertKUNV NS2B-GS-NS3
UseTagsExpressionYeastMutationPromoterGAL1Available sinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mNeonGreen
Plasmid#196864PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Need1) fused to mNeonGreenDepositorInsertNedd1-mNeonGreen (Nedd1 Rat)
UseTagsExpressionMammalianMutationPromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
MKV937/nlp-1p::FlincG3
Plasmid#140508PurposeThis construct contains cGMP biosensor driven by nlp-1 promoter for expression in PHB sensory neuron in pSMdelta backbone.DepositorInsertFlincG3
UseTagsExpressionWormMutationPromoternlp-1Available sinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot8-D40AE42A_AH
Plasmid#148902PurposeMammalian Expression of HsNot8-D40AE42ADepositorInsertHsNot8-D40AE42A (CNOT8 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX131
Plasmid#167149PurposeMoClo-compatible Level 0-SP promoterless vector encoding Aspergillus nidulans 4'-phosphopantetheinyl transferase NpgA codon-optimised for expression in Nicotiana benthamiana and Pichia pastorisDepositorInsert4'-phosphopantetheinyl transferase, npgA
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
S1 1029 CP ABEMax strategy 1
Plasmid#135357PurposeExpression of circular permutant of nSpyCas9 at amino acid position 1029 encoding ABEMax (wildtype Tada monomer coupled with evolved Tada monomer) at the N-terminusDepositorInsertABEMax-nSpyCas9 aa 1029
UseCRISPRTagsExpressionMammalianMutationWTPromoterAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX028
Plasmid#167151PurposeMoClo-compatible Level 1 (position 2) vector encoding Neonothopanus nambi hispidin synthase nnHispS under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnHispS-ocsT
UseTagsExpressionPlantMutationPromoterp35sAvailable sinceJune 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX018
Plasmid#167144PurposeMoClo-compatible Level 0-SP promoterless vector encoding Neonothopanus nambi luciferase nnLuz codon-optimised for expression in Nicotiana benthamiana and Pichia pastorisDepositorInsertfungal luciferase, nnLuz
UseLuciferase and Synthetic BiologyTagsExpressionMutationPromoterAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (WT - miR-206 site)
Plasmid#62577PurposeTranslational Luciferase Reporter containing a fragment of the 3'UTR of SPRED1 containing a miR-206 binding siteDepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX029
Plasmid#167152PurposeMoClo-compatible Level 1 (position 3) vector encoding Neonothopanus nambi hispidin-3-hydroxylase nnH3H under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnH3H-ocsT
UseTagsExpressionPlantMutationPromoterp35sAvailable sinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only