We narrowed to 13,309 results for: sequence

#52514

expresses C. elegans BLMP-1 in mammalian cells with RGS-6xHis tag at N-terminus

Adam Antebi

Horn et al Dev Cell. 2014 Mar 4. pii: S1534-5807(14

Dec. 21, 2015

Academic Institutions and Nonprofits only

#71987

Expresses the extracellular region of the Netrin G1, isoform d protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 25, 2016

Academic Institutions and Nonprofits only

#72100

Expresses the extracellular region of the Neuropilin 2, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 2, 2016

Academic Institutions and Nonprofits only

#72101

Expresses the extracellular region of the Neuropilin 2, isoform 4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 1, 2016

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#71965

Expresses the extracellular region of the Neogenin 1, isoform c protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 26, 2016

Academic Institutions and Nonprofits only

#72002

Expresses the extracellular region of the PlexinB2 protein (ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 22, 2016

Academic Institutions and Nonprofits only

#72112

Expresses the extracellular region of the Netrin G1, isoform c protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 1, 2016

Academic Institutions and Nonprofits only

#249024

This plasmid expresses the full length BRCA1 sequence (Y1845D mutation) with an N-terminal 3xFLAG tag

Georgios Karras

Gracia et al Mol Cell. 2025 Nov 19:S1097-2765(25)0086

Jan. 21, 2026

Academic Institutions and Nonprofits only

#249025

This plasmid expresses the full length BRCA1 sequence (M1775R mutation) with an N-terminal 3xFLAG tag

Georgios Karras

Gracia et al Mol Cell. 2025 Nov 19:S1097-2765(25)0086

Jan. 21, 2026

Academic Institutions and Nonprofits only