We narrowed to 78 results for: heyza
-
Plasmid#207087PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous 53BP1 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human 53BP1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-DNAPKcs HRD
Plasmid#207088PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous DNA-PKcs locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human DNAPKcs locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1
Plasmid#207108PurposepHTN HaloTag CMV-neo (Promega; #G7721) based vector to express HaloTag-MDC1 in human cells.DepositorInsertHaloTag-MDC1
TagsHaloTagExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1-Halo HRD
Plasmid#207084PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous NBS1 locus.DepositorInsertHaloTag followed by a LoxP-PuroR cassette flanked by human NBS1 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
ATM-Halo HRD
Plasmid#207082PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous ATM locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168-Halo HRD
Plasmid#207080PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RNF168 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
ExpressionMammalianPromoterNoneAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Rev7-Halo HRD
Plasmid#207079PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous REV7 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human REV7 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-MDC1 HRD
Plasmid#207086PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous MDC1 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human MDC1 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-ATM HRD
Plasmid#207085PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous ATM locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human ATM locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD3 HRD
Plasmid#207077PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD3 locus.DepositorInsertHaloTag with internal PuroR cassette flanked by human SHLD3 locus sequences
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo-SHLD1 HRD
Plasmid#207076PurposeHomologous recombination donor for insertion of a HaloTag at the N-terminus of the endogenous SHLD1 locus.DepositorInsertHaloTag flanked by human SHLD1 locus sequences (SHLD1 Human, Synthetic)
TagsHaloTagExpressionMammalianPromoterEndogenousAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Rif1-Halo HRD
Plasmid#207081PurposeHomologous recombination donor for insertion of a HaloTag at the C-terminus of the endogenous RIF1 locus.DepositorInsertHaloTag followed by a PolyA signal and PuroR cassette flanked by human RNF168 locus sequences
TagsHaloTagExpressionMammalianPromoterNoneAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only