Skip to main content

We narrowed to 844 results for: Tat

Showing: 1 - 30 of 844 results
  1. Lentivirus Plasmids

    Type
    Collection
    ...Rawlings and Andrew Scharenberg 22502 pCEP4-tat N/A Expression of tat . Increases viral titer. Sergey Kasparov...8455 pCMV-dR8.2 dvpr 2nd Contains gag , pol , rev , tat , vif , and nef . Can be used with 2nd and 3rd generation... 12260 psPAX2 2nd Contains gag , pol , rev , and tat . Can be used with 2nd and 3rd generation transfer...pCMV delta R8.2 2nd Contains gag , pol , rev , and tat . Can be used with 2nd and 3rd generation transfer...Trono 17531 pCD/NL-BH*DDD 2nd Contains gag-pol , tat , and rev . Use with envelope plasmids from Jakob...Kasparov 22500 pNHP 2nd Contains gag , pol , rev , and tat . Sergey Kasparov Return to top Popular Lentiviral...with second-generation packaging construct encoding tat . Jakob Reiser 35617 pCAG-Eco Ecotropic MLV expressing...
  2. Antibodies 101: Immunoprecipitation

    Type
    Blog Post
    ...this versatile technique.  Immunoprecipitation Overview An immunoprecipitation reaction is typically carried...Immunoprecipitation (IP) uses immobilized antibodies, or immunoglobulins, to isolate a specific protein...primary antibody Immobilization is the key to immunoprecipitation and simply refers to the process of anchoring...
  3. Addgene Depositors Get More Citations

    Type
    Blog Post
    ...Addgene plasmids get more citations So what do we find? Lots more citations for the papers with plasmids... difference in citations after controlling for journal. And so, while our quantitative analysis cannot...editing paper on CRISPR/Cas amassed nearly 2,400 citations in its first four years (1). In addition to publishing...associated with Addgene deposits accumulate more citations than those without Addgene deposits? Even more...network of articles to track the total number of citations the paper receives. From the database we pulled...papers published in other years also get many more citations This isn’t the whole story, though. It would ... great to know how much of that difference in citations is caused by depositing a plasmid with Addgene...
  4. Deep Dive: Statistical Tests (Comparisons)

    Type
    Blog Post
    ... you. Statistics – The basics Statistical analysis is what determines if there is statistical significance... several core factors of statistics relevant for many downstream statistical tests.   Independent variables...are statistically different. They are classic parametric tests and one of the simplest statistical tests...described above. Violated assumptions and statistics Statistical power, the ability to correctly identify... non-parametric statistical tests! Adding it all up  There are many, many statistical tests beyond the...your friendly neighborhood biostatistician happy by making your statistical analysis plan when you design...Wissing, Dennis R., and Timm, Donna. Statistics for the nonstatistician: Part I. South Med J., 105(3): 126...
  5. Droplet Digital PCR for AAV Quantitation

    Type
    Blog Post
    ...producing AAV vector preparations, we have used quantitative PCR to evaluate the physical titer of our preps...digital PCR (ddPCR) comes in. AAV titering using quantitative PCR Before we dive into the details of ddPCR...ddPCR, we should first note that quantitative PCR (qPCR) has been a powerful tool for quantifying AAV for...
  6. The Golden Stopwatch Award: Recognizing Facilitators of Research

    Type
    Blog Post
    ...the plasmid here yet? A quick look at your order status on addgene.org identifies the hold-up. Your Material...possible new awardees, and we’re happy to share stats and strategies with tech transfer offices. Drop ...Sloan-Kettering Cancer Center  Monash University  Montana State University  National Institute of Diabetes & Digestive...
  7. Capturing a Moment with Marc Zimmer’s “The State of Science”

    Type
    Blog Post
    ... Marc Zimmer’s recent book, The State of Science: What the Future Holds and the Scientists Making It ... ago. Teaching by example No examination of the state of science would be complete without the inclusion... last decade. He describes the detection of gravitational waves--a story I was much less familiar with...to. The problems and challenges described in The State of Science have not changed in “COVID times,” but...next week.   A stepping stone When I discussed The State of Science with the five Addgene colleagues who ... learn everything about one specific topic, The State of Science could be a jumping off point to explore...
  8. DIY DNA Ladders from Penn State University

    Type
    Blog Post
    ... Commercial DNA Ladder Penn State Ladder: Homemade Plasmid Prep Penn State Ladder: Commercial Plasmid ...undergraduate students led by Dr. Song Tan at Penn State developed the plasmids, pPSU1 and pPSU2. When restriction...$200-$500 for 1000 lanes worth of ladder. The Penn State ladders are significantly cheaper. When using a ...
  9. Deep Mutational Scanning with One Pot Saturation Mutagenesis

    Type
    Blog Post
    ...ready for deep mutational scanning.     3 reasons to be interested in deep mutational scanning Hundreds...effect of multiple mutations in combination and possibly discover unexpected epistatic changes in protein...combination of library coverage, mutational efficiency, control over where mutations are introduced, and scalability...still work if the orientation of the BbvCI site(s) of the gene are in the same orientation as those in the...Scientists use deep mutational scanning to simultaneously test how multiple amino acid changes affect...link genotype to phenotype that can be used with mutational scanning: ligand binding assays, phage display...mutagenesis Several methods can be used to create mutational scanning libraries. While each of these methods...
  10. A new platform for fast functional characterization of potentially cancerous mutations

    Type
    Blog Post
    ...Collection for “Functional Annotation of Somatic Mutations in Cancer.” Of all the mutations and fusions represented...attempting to characterize mutations in a pooled cell population, as mutations with strong phenotypic effects...types of mutations they identified included gene amplifications and fusions, missense mutations, and indels...assay allows first-time functional annotation of thousands of mutations The researchers used the collection...Kwok-Shing, et al. "Systematic functional annotation of somatic mutations in cancer." Cancer Cell 33.3 (2018)...Thousands of mutations have been implicated in cancer. Yet, the majority of them remain uncharacterized...moderate throughput functional genomic platform to annotate genetic perturbations that may play significant...
  11. Increasing Your Work's Visibility with Addgene: Citation, Search, and Collections

    Type
    Blog Post
    ...your research interests. We do this by promoting citation, supporting sophisticated search, and curating...reference for its original publication. To help facilitate this process, we explain how to cite plasmids...Addgene right on our plasmid pages and provide a citation that you can put straight into your reference ...visibility of both you and the original depositor. Our citations feature makes it so that, when you cite a plasmid...quick note -  While it is tempting to rely on the citation number when comparing two plasmids, we recommend...Impact Are Evolving Check out the Blog Post on Our Citations Feature Browse More Inside Addgene Posts Additional... citation...
  12. Recombinase-based State Machines Enable Order-dependent Logic in vivo

    Type
    Blog Post
    ...Recombinase-based state machines (RSMs), which take on a particular DNA-sequence configuration (state) based on...effects on the state cannot be undone and also limit the set of possible downstream states that can be achieved...order of inputs results in only one final state, then the state of the RSM will tell you precisely what ...might one read the state of an RSM? The most straightforward way to read the state of an RSM is to sequence...is to interrogate state with qPCR. The re-arrangement of DNA segments in each state of a register enables...certain states of interest. For example, in Figure 2 below we present a two-input, five-state GRSM register...green fluorescent proteins in each state. The three methods of state interrogation mentioned above (Sanger...
  13. Don’t FRET: Bimolecular Fluorescence Complementation Makes Visualizing Protein-Protein Interactions Easy

    Type
    Blog Post
    ...Bimolecular Fluorescence Complementation (BiFC). What is bimolecular fluorescence complementation? Bimolecular fluorescence... TK (2006) Design and implementation of bimolecular fluorescence complementation (BiFC) assays for the... fluorescence complementation is a method for detecting protein-protein interactions that uses split fluorescent...  Applications for bimolecular fluorescence complementation BiFC has been used to directly visualize PPIs...success of BiFC experiments. The ideal control is a mutated variant of one or both of your PIPs in which the...Living Cells Using Bimolecular Fluorescence Complementation. Molecular Cell 9:789–798. https://doi.org/...Kerppola TK (2013) Bimolecular Fluorescence Complementation (BiFC) Analysis of Protein Interactions in ...
  14. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ...wildtype 5'LTR, which requires the presence of the Tat protein to work, while 3rd-generation transfer plasmids...chimeric 5'LTR removes the requirement for the HIV Tat protein, thus decreasing the probability of creating...plasmid encoding HIV proteins gag, pol, rev, and tat. 3rd generation systems require an envelope plasmid...transfer plasmid to eliminate the need for the HIV Tat protein and consequently are considered safer. Second-generation...system because the wildtype 5'LTR promoter requires Tat to function. Third-generation plasmids can be packaged...Second-generation contains those three genes plus tat. The envelope plasmid provides a heterologous envelope...biosafety available for the technology. The minor limitation in using the 3rd-generation system is that it...
  15. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...asyn Q79E (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105733 pET11a asyn Q79N (TAC-->TAT) SNCA T7 Parkinson's...asyn Q99E (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105735 pET11a asyn Q109E (TAC-->TAT) SNCA T7 Parkinson's...Q109H) (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105737 pET11a asyn Q109N (TAC-->TAT) SNCA T7 Parkinson's...Hilal Lashuel 105738 pET11a asyn Q79N Q109N (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105739 pT7-7 asyn...GRN mutation carriers Dirk Daelemans 237542 TDP-43 WT GFP TDP-43 GFP CMV Alzheimer's, ALS Tatyana Shelkovnikova...Alzheimer's, ALS Tatyana Shelkovnikova 237544 TDP-43 3M GFP TDP-43 GFP CMV Alzheimer's, ALS Tatyana Shelkovnikova...Alzheimer's, ALS Tatyana Shelkovnikova 237546 TDP-43 deltaNTD GFP TDP-43 GFP CMV Alzheimer's, ALS Tatyana Shelkovnikova...
  16. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    ...virus. Second, Tat is eliminated through the addition of a chimeric 5’ LTR containing a Tat-independent ...polymerase), Tat (viral transactivator for transcriptional activation from the 5’ LTR) and Rev (facilitates nuclear...transfer plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due...envelope plasmid contained a viral envelope to dictate the tropism, or types of cells the vector could...flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral packaging and host genome integration. ...
  17. Lentiviral Vector Guide

    Type
    Guide
    ...include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat for activation...lentiviruses additionally require the regulatory genes tat and rev , along with virus-specific accessory genes...packaging genes gag and pol , and regulatory genes tat and rev ; separated into two plasmids in third generation...wild-type LTRs Packaging plasmid — contains gag , pol , tat , and rev Envelope plasmid — contains env All second-generation...system because transgene expression from the LTR is Tat-dependent. Figure 3: Second-generation lentiviral...viral titers due to the additional plasmid. Second, tat is not required in the third-generation system. Instead...RSV), eliminating the need for transactivation by Tat. Most third-generation transfer plasmids also contain...
  18. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...for the production of a viral particle (Gag, Pol, Tat, Rev and Env) and the transfer plasmid encoding the... a clinical setting. In this generation, the HIV Tat gene (previously used to drive expression from the... has been inserted in this LTR so you don’t need Tat to transcribe the viral genome in producing cells...the LTRs) has been removed, Rev (which facilitates nuclear export) is expressed from a separate plasmid...active area of research due to the possibility that mutation or recombination with human retroviruses could... In this case, your gene is repressed in steady state and is expressed when Dox is added to the culture...centrifuge the culture supernatant in order to precipitate the viral particles. Some protocols suggest adding...
  19. Another Pathway into Cells: iTOP

    Type
    Blog Post
    .... One such CPP was discovered in the HIV protein Tat. Although CPP fusions can translocate a cell membrane...toxin, indicating a 70% frequency of biallelic mutations. Importantly, hESCs retained their stemness, indicating... remove the risk of viral integration causing mutations and gene expression changes elsewhere in the genome..., working directly with proteins removes the limitations of packaging size associated with viral vectors...
  20. Overcoming the Challenges of Lentiviral Production

    Type
    Blog Post
    ...longer requires the viral transactivator, Tat. For more information on the different generations of lentiviral...promoter of the 5’ long terminal repeat (LTR) is mutated in third generation systems such that it no longer...spin columns, and polyethylene glycol (PEG) precipitation. All of these methods ultimately isolate the...downstream applications. For example, while the PEG precipitation method is relatively inexpensive and does not...not require an ultracentrifuge, PEG will precipitate all proteins in a solution, not just the lentivirus...
  21. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ...- Renaturing Solution (Potassium Acetate) 120 mL 5M Potassium acetate 23 mL glacial acetic acid 57 mL ...isopropanol 90% ethanol 70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification...down causing the proteins and genomic DNA to precipitate, while leaving the smaller plasmids free in solution...supernatant. Add either ethanol or isopropanol to precipitate the plasmid DNA. Either spin to pellet the DNA... solution to a column that will bind the now precipitated DNA. Wash the pellet or column with 70% ethanol...tube. Mix by inverting several times. A white precipitate will be formed which contains the bacterial proteins...room temperature isopropanol to the solution to precipitate the plasmid DNA; see detailed protocol below ...
  22. Kit Free RNA Extraction

    Type
    Protocol
    ...Isopropanol (for precipitation step, Option A) 7.5 M Lithium Chloride (for precipitation step, Option B)...Glycogen may be used as a carrier to facilitate RNA precipitation. This does not affect the quality of...lysis of cells or tissues, extraction of RNA, precipitation, and resuspension. This protocol provides two...thiocyanate-phenol solution such as TRIzol®. For the precipitation step, two options are also included: using Isopropanol...Protocol Option #2) Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol...sequentially to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL...
  23. Hot Plasmids February 2024

    Type
    Blog Post
    ...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP...co-incubate it with an “assist peptide” that facilitates endosomal escape. Combining Cas9-PAGE with lentiviral...Balasubramanian and colleagues showed the single mutation E138D is sufficient to disrupt dimerization while...
  24. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...into a backbone vector of choice with minimal limitations. Background In its simplest form, PCR based cloning.... Remember to insert your DNA in the correct orientation in the recipient plasmid by viewing the MCS and...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...
  25. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...verification of the orientation so long as the expected products from each orientation are different sizes...digest to verify plasmid size, verify insert orientation, and more. Protocols...you have the correct plasmid. Verifying Insert Orientation by Restriction Digest If you clone an insert ... verify that it has be cloned in the correct orientation - this can be done by restriction digest. Although...have to do so, there is no way to control which orientation the insert is ligated into the vector backbone...clone(s) in which the insert is in the correct orientation. In the example below we want to know how to ... between two clones that differ only in the orientation of the insert. By choosing an enzyme (or enzymes...
  26. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...
  27. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG...tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector’s preintegration...CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO.1 The pLKO.1-TRC cloning vector...assay: Assay Days post-infection mRNA knockdown (quantitative PCR) ≥3 days Protein knockdown (western blot...
  28. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...restriction sites that are also present in the same orientation on your target vector. If you are not sure what...Will result in your insert being in the correct orientation in the recipient plasmid. (You don't want to ...verify that the insert was cloned in the correct orientation. If you cannot find enzymes that meet these criteria...flank your insert and will result in correct orientation in the recipient plasmid, it is useful to see...compatible overhangs you will need to verify the orientation of your insert, so you may want to design a diagnostic...
  29. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...instructions if you are unsure of the correct orientation of the gel. Carefully remove the comb from the...gel with deionized water for 5 min with gentle agitation on a rocking platform. Pour off the water in the...SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue...deionized water and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the...
Showing: 1 - 30 of 844 results