...-based) system Nolan 22502 pCEP4-tat N/A Packaging Expression of tat; increases viral titer Kasparov 22501...construct encoding Tat. Reiser 17531 pCD/NL-BH*DDD 2nd Packaging Contains Gag/Pol, Tat, Rev. Use with envelope...psPAX2 2nd Packaging Contains Gag, Pol, Rev, and Tat; can be used with 2nd and 3rd generation transfer...delta R8.2 2nd Packaging Contains Gag, Pol, Rev, and Tat; can be used with 2nd and 3rd generation transfer...pCMV-dR8.2 dvpr 2nd Packaging Contains Gag, Pol, Rev, Tat, Vif, and Nef; can be used with 2nd and 3rd generation...Kasparov 22500 pNHP 2nd Packaging Contains gag, pol, tat, rev Kasparov 1732 pCPRDEnv 2nd Packaging part of... in human MSCs. Use packaging construct encoding Tat. Reiser Return to Top Popular Lentiviral Transfer...

...WZLneo-Cre Cre 5'LTR Retroviral Ge 35619 pTAT-CRE Cre fused to HIV-TAT Bacterial Dowdy 36915 pJJH1320 Cre Bacterial...Mammalian Kahn 13763 pTriEx-HTNC Cre fused to HIV-TAT - promotes cellular uptake of recombinant Cre Bacterial...recombinase recognizes 34 bp loxP sites, and the orientation and location of the loxP sites determines how...are on the same DNA strand and are in opposite orientations, recombination results in an inversion and the...higher levels in mice than P1 bacteriophage Cre, facilitating high rates of Cre-driven recombination. CREM...-WPRE-BGH-polyA mCherry and Cre; expressed in excitatory neurons aCamKII AAV Yang 107738 pAAV-hSyn-Cre-P2A-dTomato...The FLEx switch system takes advantage of the orientation specificity of Cre and the different types of...

...this versatile technique.  Immunoprecipitation Overview An immunoprecipitation reaction is typically carried...Immunoprecipitation (IP) uses immobilized antibodies, or immunoglobulins, to isolate a specific protein...primary antibody Immobilization is the key to immunoprecipitation and simply refers to the process of anchoring...

... you. Statistics – The basics Statistical analysis is what determines if there is statistical significance... several core factors of statistics relevant for many downstream statistical tests.   Independent variables...are statistically different. They are classic parametric tests and one of the simplest statistical tests...described above. Violated assumptions and statistics Statistical power, the ability to correctly identify... non-parametric statistical tests! Adding it all up  There are many, many statistical tests beyond the...your friendly neighborhood biostatistician happy by making your statistical analysis plan when you design...Wissing, Dennis R., and Timm, Donna. Statistics for the nonstatistician: Part I. South Med J., 105(3): 126...

...Addgene plasmids get more citations So what do we find? Lots more citations for the papers with plasmids... difference in citations after controlling for journal. And so, while our quantitative analysis cannot...editing paper on CRISPR/Cas amassed nearly 2,400 citations in its first four years (1). In addition to publishing...associated with Addgene deposits accumulate more citations than those without Addgene deposits? Even more...network of articles to track the total number of citations the paper receives. From the database we pulled...papers published in other years also get many more citations This isn’t the whole story, though. It would ... great to know how much of that difference in citations is caused by depositing a plasmid with Addgene...

...producing AAV vector preparations, we have used quantitative PCR to evaluate the physical titer of our preps...digital PCR (ddPCR) comes in. AAV titering using quantitative PCR Before we dive into the details of ddPCR...ddPCR, we should first note that quantitative PCR (qPCR) has been a powerful tool for quantifying AAV for...

...the plasmid here yet? A quick look at your order status on addgene.org identifies the hold-up. Your Material...possible new awardees, and we’re happy to share stats and strategies with tech transfer offices. Drop ...Sloan-Kettering Cancer Center  Monash University  Montana State University  National Institute of Diabetes & Digestive...

..., increasing overall packaging capacity but necessitating purification and co-infection of two AAVs. ...

... Marc Zimmer’s recent book, The State of Science: What the Future Holds and the Scientists Making It ... ago. Teaching by example No examination of the state of science would be complete without the inclusion... last decade. He describes the detection of gravitational waves--a story I was much less familiar with...to. The problems and challenges described in The State of Science have not changed in “COVID times,” but...next week.   A stepping stone When I discussed The State of Science with the five Addgene colleagues who ... learn everything about one specific topic, The State of Science could be a jumping off point to explore...

... Commercial DNA Ladder Penn State Ladder: Homemade Plasmid Prep Penn State Ladder: Commercial Plasmid ...undergraduate students led by Dr. Song Tan at Penn State developed the plasmids, pPSU1 and pPSU2. When restriction...$200-$500 for 1000 lanes worth of ladder. The Penn State ladders are significantly cheaper. When using a ...

...ready for deep mutational scanning.     3 reasons to be interested in deep mutational scanning Hundreds...effect of multiple mutations in combination and possibly discover unexpected epistatic changes in protein...combination of library coverage, mutational efficiency, control over where mutations are introduced, and scalability...still work if the orientation of the BbvCI site(s) of the gene are in the same orientation as those in the...Scientists use deep mutational scanning to simultaneously test how multiple amino acid changes affect...link genotype to phenotype that can be used with mutational scanning: ligand binding assays, phage display...mutagenesis Several methods can be used to create mutational scanning libraries. While each of these methods...

...your research interests. We do this by promoting citation, supporting sophisticated search, and curating...reference for its original publication. To help facilitate this process, we explain how to cite plasmids...Addgene right on our plasmid pages and provide a citation that you can put straight into your reference ...visibility of both you and the original depositor. Our citations feature makes it so that, when you cite a plasmid...quick note -  While it is tempting to rely on the citation number when comparing two plasmids, we recommend...Impact Are Evolving Check out the Blog Post on Our Citations Feature Browse More Inside Addgene Posts Additional... citation...

...Collection for “Functional Annotation of Somatic Mutations in Cancer.” Of all the mutations and fusions represented...attempting to characterize mutations in a pooled cell population, as mutations with strong phenotypic effects...types of mutations they identified included gene amplifications and fusions, missense mutations, and indels...assay allows first-time functional annotation of thousands of mutations The researchers used the collection...Kwok-Shing, et al. "Systematic functional annotation of somatic mutations in cancer." Cancer Cell 33.3 (2018)...Thousands of mutations have been implicated in cancer. Yet, the majority of them remain uncharacterized...moderate throughput functional genomic platform to annotate genetic perturbations that may play significant...

...Recombinase-based state machines (RSMs), which take on a particular DNA-sequence configuration (state) based on...effects on the state cannot be undone and also limit the set of possible downstream states that can be achieved...order of inputs results in only one final state, then the state of the RSM will tell you precisely what ...might one read the state of an RSM? The most straightforward way to read the state of an RSM is to sequence...is to interrogate state with qPCR. The re-arrangement of DNA segments in each state of a register enables...certain states of interest. For example, in Figure 2 below we present a two-input, five-state GRSM register...green fluorescent proteins in each state. The three methods of state interrogation mentioned above (Sanger...

...Bimolecular Fluorescence Complementation (BiFC). What is bimolecular fluorescence complementation? Bimolecular fluorescence... TK (2006) Design and implementation of bimolecular fluorescence complementation (BiFC) assays for the... fluorescence complementation is a method for detecting protein-protein interactions that uses split fluorescent...  Applications for bimolecular fluorescence complementation BiFC has been used to directly visualize PPIs...success of BiFC experiments. The ideal control is a mutated variant of one or both of your PIPs in which the...Living Cells Using Bimolecular Fluorescence Complementation. Molecular Cell 9:789–798. https://doi.org/...Kerppola TK (2013) Bimolecular Fluorescence Complementation (BiFC) Analysis of Protein Interactions in ...

...wildtype 5'LTR, which requires the presence of the Tat protein to work, while 3rd-generation transfer plasmids...chimeric 5'LTR removes the requirement for the HIV Tat protein, thus decreasing the probability of creating...plasmid encoding HIV proteins gag, pol, rev, and tat. 3rd generation systems require an envelope plasmid...transfer plasmid to eliminate the need for the HIV Tat protein and consequently are considered safer. Second-generation...system because the wildtype 5'LTR promoter requires Tat to function. Third-generation plasmids can be packaged...Second-generation contains those three genes plus tat. The envelope plasmid provides a heterologous envelope...biosafety available for the technology. The minor limitation in using the 3rd-generation system is that it...

...asyn Q79E (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105733 pET11a asyn Q79N (TAC-->TAT) SNCA T7 Parkinson's...asyn Q99E (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105735 pET11a asyn Q109E (TAC-->TAT) SNCA T7 Parkinson's...Q109H) (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105737 pET11a asyn Q109N (TAC-->TAT) SNCA T7 Parkinson's...Hilal Lashuel 105738 pET11a asyn Q79N Q109N (TAC-->TAT) SNCA T7 Parkinson's Hilal Lashuel 105739 pT7-7 asyn...below can be sorted by disease, plasmid type, mutations, and/or tags such as fluorescent protein (FP) ...Initiative, MedGen, ClinVar) and is meant to be representative but not exhaustive. If you do not see a particular...Tiago Outeiro 87443 pTBK1 TBK1 CMV ALS Georgios Stathopoulos 87633 Tau (P301L)-VC MAPT Venus CMV Parkinson's...

...and partially spliced transcripts to facilitate nuclear export. Tat in trans Second generation only; Trans-activator...packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. The transfer plasmid contains the viral LTRs... is a weak promoter and requires the presence of Tat to activate expression. The envelope protein Env ...system because transgene expression from the LTR is Tat-dependent. Second Generation Lentiviral Plasmids ... the addition of one additional plasmid. Second, Tat is eliminated from the 3rd generation system through...transgene from this promoter is no longer dependent on Tat transactivation. The 3rd generation transfer plasmid...second generation packaging system that includes TAT Can be packaged by both 2nd and 3rd generation packaging...

...virus. Second, Tat is eliminated through the addition of a chimeric 5’ LTR containing a Tat-independent ...polymerase), Tat (viral transactivator for transcriptional activation from the 5’ LTR) and Rev (facilitates nuclear...transfer plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due...envelope plasmid contained a viral envelope to dictate the tropism, or types of cells the vector could...flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral packaging and host genome integration. ...

...for the production of a viral particle (Gag, Pol, Tat, Rev and Env) and the transfer plasmid encoding the... a clinical setting. In this generation, the HIV Tat gene (previously used to drive expression from the... has been inserted in this LTR so you don’t need Tat to transcribe the viral genome in producing cells...the LTRs) has been removed, Rev (which facilitates nuclear export) is expressed from a separate plasmid...active area of research due to the possibility that mutation or recombination with human retroviruses could... In this case, your gene is repressed in steady state and is expressed when Dox is added to the culture...centrifuge the culture supernatant in order to precipitate the viral particles. Some protocols suggest adding...

.... One such CPP was discovered in the HIV protein Tat. Although CPP fusions can translocate a cell membrane...toxin, indicating a 70% frequency of biallelic mutations. Importantly, hESCs retained their stemness, indicating... remove the risk of viral integration causing mutations and gene expression changes elsewhere in the genome..., working directly with proteins removes the limitations of packaging size associated with viral vectors...

...longer requires the viral transactivator, Tat. For more information on the different generations of lentiviral...promoter of the 5’ long terminal repeat (LTR) is mutated in third generation systems such that it no longer...spin columns, and polyethylene glycol (PEG) precipitation. All of these methods ultimately isolate the...downstream applications. For example, while the PEG precipitation method is relatively inexpensive and does not...not require an ultracentrifuge, PEG will precipitate all proteins in a solution, not just the lentivirus...

...plasmids are determined by the presence/absence of Tat, a protein found only in lentivirus. Are γ-retroviruses...by long terminal repeat (LTR) sequences, which facilitate integration of the transfer plasmid sequences...

...Figure 1: A) Cell-penetrating Cas9, fused to HIV TAT, Myc and SV40 Nuclear Localization Signals, and GFP...co-incubate it with an “assist peptide” that facilitates endosomal escape. Combining Cas9-PAGE with lentiviral...Balasubramanian and colleagues showed the single mutation E138D is sufficient to disrupt dimerization while...

...- Renaturing Solution (Potassium Acetate) 120 mL 5M Potassium acetate 23 mL glacial acetic acid 57 mL ...isopropanol 90% ethanol 70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification...down causing the proteins and genomic DNA to precipitate, while leaving the smaller plasmids free in solution...supernatant. Add either ethanol or isopropanol to precipitate the plasmid DNA. Either spin to pellet the DNA... solution to a column that will bind the now precipitated DNA. Wash the pellet or column with 70% ethanol...tube. Mix by inverting several times. A white precipitate will be formed which contains the bacterial proteins...room temperature isopropanol to the solution to precipitate the plasmid DNA; see detailed protocol below ...

...Isopropanol (for precipitation step, Option A) 7.5 M Lithium Chloride (for precipitation step, Option B)...Glycogen may be used as a carrier to facilitate RNA precipitation. This does not affect the quality of...lysis of cells or tissues, extraction of RNA, precipitation, and resuspension. This protocol provides two...thiocyanate-phenol solution such as TRIzol®. For the precipitation step, two options are also included: using Isopropanol...Protocol Option #2) Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol...sequentially to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL...

...into a backbone vector of choice with minimal limitations. Background In its simplest form, PCR based cloning.... Remember to insert your DNA in the correct orientation in the recipient plasmid by viewing the MCS and...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...

...verification of the orientation so long as the expected products from each orientation are different sizes...digest to verify plasmid size, verify insert orientation, and more. Protocols...you have the correct plasmid. Verifying Insert Orientation by Restriction Digest If you clone an insert ... verify that it has be cloned in the correct orientation - this can be done by restriction digest. Although...have to do so, there is no way to control which orientation the insert is ligated into the vector backbone...clone(s) in which the insert is in the correct orientation. In the example below we want to know how to ... between two clones that differ only in the orientation of the insert. By choosing an enzyme (or enzymes...

...Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...

...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG...tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector’s preintegration...CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO.1 The pLKO.1-TRC cloning vector...assay: Assay Days post-infection mRNA knockdown (quantitative PCR) ≥3 days Protein knockdown (western blot...