Skip to main content
Addgene
Showing: 1 - 20 of 25 results
  1. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ...- Renaturing Solution (Potassium Acetate) 120 mL 5M Potassium acetate 23 mL glacial acetic acid 57 mL ...isopropanol 90% ethanol 70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized DNA Purification...down causing the proteins and genomic DNA to precipitate, while leaving the smaller plasmids free in solution...supernatant. Add either ethanol or isopropanol to precipitate the plasmid DNA. Either spin to pellet the DNA... solution to a column that will bind the now precipitated DNA. Wash the pellet or column with 70% ethanol...tube. Mix by inverting several times. A white precipitate will be formed which contains the bacterial proteins...room temperature isopropanol to the solution to precipitate the plasmid DNA; see detailed protocol below ...
  2. Kit Free RNA Extraction

    Type
    Protocol
    ...Isopropanol (for precipitation step, Option A) 7.5 M Lithium Chloride (for precipitation step, Option B)...Glycogen may be used as a carrier to facilitate RNA precipitation. This does not affect the quality of...lysis of cells or tissues, extraction of RNA, precipitation, and resuspension. This protocol provides two...thiocyanate-phenol solution such as TRIzol®. For the precipitation step, two options are also included: using Isopropanol...Protocol Option #2) Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol...sequentially to 1 mL of lysate: Add 0.1 mL of 2 M sodium acetate (pH 4.0), mix thoroughly by inversion. Add 1 mL...
  3. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...into a backbone vector of choice with minimal limitations. Background In its simplest form, PCR based cloning.... Remember to insert your DNA in the correct orientation in the recipient plasmid by viewing the MCS and...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...
  4. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...verification of the orientation so long as the expected products from each orientation are different sizes...digest to verify plasmid size, verify insert orientation, and more. Protocols...you have the correct plasmid. Verifying Insert Orientation by Restriction Digest If you clone an insert ... verify that it has be cloned in the correct orientation - this can be done by restriction digest. Although...have to do so, there is no way to control which orientation the insert is ligated into the vector backbone...clone(s) in which the insert is in the correct orientation. In the example below we want to know how to ... between two clones that differ only in the orientation of the insert. By choosing an enzyme (or enzymes...
  5. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...
  6. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...(AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG...CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG...tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector’s preintegration...CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO.1 The pLKO.1-TRC cloning vector...assay: Assay Days post-infection mRNA knockdown (quantitative PCR) ≥3 days Protein knockdown (western blot...
  7. Plasmid Cloning by Restriction Enzyme Digest (with Protocols)

    Type
    Protocol
    ...restriction sites that are also present in the same orientation on your target vector. If you are not sure what...Will result in your insert being in the correct orientation in the recipient plasmid. (You don't want to ...verify that the insert was cloned in the correct orientation. If you cannot find enzymes that meet these criteria...flank your insert and will result in correct orientation in the recipient plasmid, it is useful to see...compatible overhangs you will need to verify the orientation of your insert, so you may want to design a diagnostic...
  8. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...instructions if you are unsure of the correct orientation of the gel. Carefully remove the comb from the...gel with deionized water for 5 min with gentle agitation on a rocking platform. Pour off the water in the...SimplyBlue SafeStain and incubate for 1 h with gentle agitation on a rocking platform. Pour off the SimplyBlue...deionized water and incubate for 1 h with gentle agitation on a rocking platform. Pour off the water in the...
  9. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...mismatch/mutation may be the result of a mis-called peak in the trace file. If the mutation is not an...such as the gene/insert, fusion proteins, point mutations, deletions, etc.) involves selecting one or more...Addgene sequences the plasmid to verify tags, mutations and a portion of the insert, but we do not sequence...
  10. CRISPR Library Amplification

    Type
    Protocol
    ...and plasmid recombination can all impact the representation of individual plasmids in the pooled library...individual libraries may require modifications dictated by the originating laboratory for optimal results...adequate NGS based QC to ensure no change in representation compared to the pre-amplified stock. A last...note that NGS should be performed to ensure representation is maintained. Maxipreps - Less is more: Do...
  11. Centrifugation

    Type
    Protocol
    ...that can hold larger containers, but they can also rotate at much higher speeds and are used for more specialized...balanced. Using the centrifuge in an unbalanced state can damage the centrifuge and be dangerous for the...
  12. Lab Safety for Biosafety Levels One and Two

    Type
    Protocol
    ...contact with hazardous materials. A sink, eyewash station, safety shower, fire blanket, and extinguisher ... are located before you start. Use the eyewash station if unwanted or biohazardous materials are splashed...
  13. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...that the insert will be added in the correct orientation and prevents the vector from ligating to itself...indicates the various controls: Control Ligase Interpretation Uncut vector - Checks viability of competent...
  14. Pouring LB Agar Plates

    Type
    Protocol
    ...autoclave, you should prepare your plate pouring station: Find an empty section of lab bench with a working...thermometer. Light the flame at the plate pouring station and dilute your antibiotic into your ~60 ℃ molten...
  15. AAV Production in HEK293 Cells

    Type
    Protocol
    ...for 3 h without stirring to allow full precipitation. Precipitation of the viruses can proceed overnight...
  16. Gibson Assembly Protocol

    Type
    Protocol
    ...making a small change in a plasmid (such as point mutations). Generate DNA segments by PCR. Run PCR product...
  17. Colony Formation Titering Assay

    Type
    Protocol
    ...solution through a 0.22 μm filter to remove any precipitates. Stain each well with 1 mL of 0.1% crystal violet...
  18. Pipetting Protocol

    Type
    Protocol
    ...Depending on the pipette you’re using, you will be rotating dials behind the numerical display or the top ...
Showing: 1 - 20 of 25 results