Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 33 results for: id numbers

Showing: 1 - 30 of 33 results

  1. Unique and persistent IDs for improved reproducibility: Addgene now supports RRIDs and compact identifiers for all plasmids

    Type
    Blog Post
    ...plasmids. All plasmids at Addgene have unique ID numbers associated with them, which serve as unique PIDs... contain the Addgene ID # and the information necessary to indicate that this ID is managed by Addgene... to wasted time or retractions. Using a catalog number for identifying a reagent can be helpful, but it...online. Furthermore, if the link between the catalog number and reagent description is lost (e.g. a supplier...supplier is bought out by another company and catalog number changes) the original identifier loses its meaning... PIDs within the Addgene catalog. These IDs allow you to unmistakably identify a plasmid available through...about each plasmid item. Given a specific Addgene ID # listed in a publication, you can quickly pull up...

  2. Increasing Your Work's Visibility with Addgene: Citation, Search, and Collections

    Type
    Blog Post
    ...request that you cite it using both its Addgene ID number as well as the reference for its original publication...plasmid from Addgene using its unique Addgene ID number, your publication will be listed on our website... can search for plasmids by name, PI, Addgene ID number, or keyword. Although an initial search might ...-  While it is tempting to rely on the citation number when comparing two plasmids, we recommend reviewing...in the repository, our scientists have curated a number of special collections pages. These pages serve...

  3. Introducing Addgene's New Search - Find Plasmids More Easily For Your Research!

    Type
    Blog Post
    ...able to include specific plasmid ID numbers. If you know the ID number for a plasmid, your straightforward...our own CSO. But what if you don’t have plasmid ID numbers, or you aren’t sure if any plasmids from a paper...potential results. Just as in the previous layout, the number of plasmids matching each filter is displayed in... Only see plasmids with more than the indicated number of requests Availability to Industry: Restrict ... associated plasmids through the article’s PubMed ID (PMID) ...or DOI Or get some keywords close enough...

  4. Tips from the Repository Trenches: Using Barcodes to Track Samples

    Type
    Blog Post
    ...been barcoded with a unique ID number (1D barcode as shown below). This number ensures that every sample...lab ensure that sample ID’s are unique, consistently labeled, and that numbers are not switched around... deposits is received in the lab, although this number fluctuates throughout the year (see graph below... to 96 tubes (see image below). Each plate has numbers and letters to give coordinates, from A1 through...each plasmid so that we never run out. There are a number of different strains of E. coli that can be used...barcode to the container holding the tubes and use this ID to name the corresponding Excel sheet.3. Be specific...

  5. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...the plasmids in the library in a single tube. The number of unique plasmids in a pooled library can range...us at [email protected]. Include your deposit number and which data needs to be updated. When your plasmids...entering the data. This step associates an Addgene ID with your plasmids, and adding all the plasmids at...likelihood that the plasmids are given sequential IDs.   Name – we encourage the use of descriptive plasmid...include the total size of the insert and the GenBank ID associated with your insert. Pro Tip! If the correct...and the vector type. Pro Tip! Reference the Addgene ID in the "Backbone Manufacturer" box for backbones ... Confirmation email from us with a unique Deposit ID. Addgene will send you a package containing instructions...

  7. Dos & Don'ts When Publishing a Scientific Manuscript

    Type
    Blog Post
    ...world of science publishing, and an ever increasing number of journals and publishers to choose from, it gets...needing a subscription to the journal. An increasing number of funding bodies insist that the research data...information on lab resources, such as catalogue numbers and manufacturers’ details for antibodies, plasmids... asked to add an identifier (a bit like a GenBank ID) to all antibodies, animal models, and software tools...

  8. Viral Genome Sequencing - A One Stop Shop for AAV Identity and Serotype Confirmation

    Type
    Blog Post
    ...to assess purity. For labs that produce a small number of AAV preparations this level of quality control... viral vector core facilities producing a large number of viral preparations in parallel, there is a very..., Moullier P, Ayuso E, Vandenberghe LH (2017) AAV-ID: A Rapid and Robust Assay for Batch-to-Batch Consistency...

  10. Lentivirus ddPCR Titration

    Type
    Protocol
    ...green) and negative (black) droplets Sample ID Plasmid ID Dilution Copies/20 µL RRE (FAM) Copies/20 µL... transducing units and generally represents the number of infectious viral particles. Users may need to...primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244 Reagent ...1600 To calculate the titers, first calculate the number of viruses per cellular genome: Since the cellular...

  11. Summer SciComm: Preprints

    Type
    Blog Post
    ...applications. A number of organizations (such as ASAPbio) advocate for preprints, and a growing number of funding...is valuable, modern scientific publishing has a number of drawbacks, especially the increasingly growing...significantly sooner. Plus, authors can include the Addgene ID for their deposited plasmids in the final journal...

  12. Plasmids 101: A Brief History of Plasmids and an Improved eBook!

    Type
    Blog Post
    ..., and pUC were developed to provide higher copy number vectors that could be used in these cloning experiments...“plasmid” derived as a hybrid of "cytoplasm" and "id" (Latin for 'it'), as “a generic term for any extrachromsomal...

  13. The Challenges of Cell Culture

    Type
    Blog Post
    ...throw them away and thaw a new batch. The exact number of passages can vary between cells lines, as this... broadly recommended that the lower the passage number the better for experiments. This is to ensure the...and Working stocks of cell lines have the passage number recorded on the outside of the vial and in a cryostore...the front of the incubator containing the passage number, cell line, and date, which you complete each time...wishes to use these cells can see their passage number and key details at a glance. You should also monitor...Short Tandem Repeat (STR) profiling can be used to ID the cell line. The same test is so good that it is...

  14. Common Injection Routes in Mice

    Type
    Blog Post
    ...Deciding which type of injection to use depends on a number of factors. You have to weigh the pros and cons...what’s being injected, the type of experiment, the number of mice, the potential pain or discomfort of the...Skill required: beginner Intradermal Intradermal (ID) injections occur between the layers of the skin....

  15. Supporting Reproducibility with a Connected ELN

    Type
    Blog Post
    ...is reproducible, and only the highly restricted number of people who can access the ELN have the ability... data repositories Over the past decade or so a number of general purpose repositories have been launched... It’s possible to associate the depositor’s ORCID ID with the deposit, and a DOI is added to the deposit...

  16. Tips for arabidopsis transformation

    Type
    Blog Post
    ...inflorescences begin to grow. This will also increase the number of inflorescences overall, which may improve transformation...transgene. You can optionally remove them to reduce the number of non-transformed seeds from the pool you will...https://books.google.at/books/about/Arabidopsis.html?id=IfZAMNPWVk4C&redir_esc=y (Accessed: 21 September ...

  17. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) as a percentage...tagging experiments: Retrieve Ensembl Transcript ID(s) of your favourite gene(s) from Ensembl genome ...index.html Design crRNA/ssODN: Using Ensembl Transcript ID(s) as an input query, pick crRNA (guide RNA sequence...

  18. Lab Automation at Addgene

    Type
    Blog Post
    ...Handler and we program the handler to fill a specific number of vials with a specific amount of agar. There ...removable parts to fit on the deck of the Biomek. The FXP id also able to do high throughput DNA preps and other...

  19. Michael J Fox Foundation (MJFF) Plasmid Collection

    Type
    Collection
    ...Michael J. Fox Foundation Plasmids MJFF has created a number of plasmids for expression of variants of LRRK2...Labs affiliated with MJFF have also generated a number of Shared Research Tools (Link opens in a new window...proteins of interest. Browse or search the table below. ID Plasmid Gene/Insert Mutations Industry Return to ...deposited with Addgene. Browse or search the table below. ID Plasmid Description Gene/Insert Industry PI Return...

  21. DNA Service - Cloning Grade DNA

    Type
    Collection
    ...Looking For? At this time, Addgene has made a limited number of plasmids available as cloning grade DNA that...sequencing Plasmids Available as Cloning Grade DNA ID Plasmid Description Industry PI FAQ What Quality ...

  22. TALEN Engineering

    Type
    Collection
    ...REAL-Fast assembly process or lists of plasmid ID numbers required for FLASH assembly. Links to additional...

  23. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...knockout library is available alongside a growing number of CRISPR libraries from Addgene’s repository that...by utilizing pre-assembled trimers to reduce the number of cloning steps. The FusX system was verified ...like CLIP require a specific antibody and a large number of cells to analyze. A new technique from Michael...different promoters in the kit and by altering the number of tandemly expressed gRNAs respectively) and 2...immunohistochemistry, and are summarized in the table below:   ID Cv (Capsid) FLAG Tag Terminus 79629 (N) and 79628... Neurosci 2016. PubMed PMID: 26950006 Plasmid ID Plasmid Name Plasmid Type 74309 pcDNA3.0-TRPV4-...

  24. Lentivirus Plasmids

    Type
    Collection
    ...lentiviral transfer plasmid are size (i.e., a limited number of basepairs of nucleic acid can fit into a viral...with 2nd and 3rd generation lentivirus technologies. ID Plasmid Generation Type Description PI 12253 pRSV-Rev...CRISPR Empty gRNA plasmids table and search "lenti". ID Plasmid Generation Description PI 8453 pLKO.1 puro...

  25. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...editors with distinct PAM sequences, expanding the number of available target sites for base editing. For...editing for precise genome modification. Plasmid ID Plasmid Name Cas9 Variant Speacial Features 85169...

  26. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...therefore, may not be suitable for use when the number of cells is limited (e.g. primary cells). Most ... to knockout, activate or repress target genes. Number of gRNAs - A given CRISPR library may target the...Subpool Viral Prep Available Yes No Clear Filters Name ID Library Type Species PI Lentiviral Generation gRNAs...

  27. TALEN Plasmids and Kits

    Type
    Collection
    ...Kit. These modified pFUS vectors can reduce the number of module plasmids and improve the success rate...Plasmids for Use with Addgene TALEN Kits For Use With: ID Plasmid Depositing PI Description Golden Gate TALEN...

  28. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Plasmids In addition to EYFP and ChR2-EYFP, a large number of additional, validated molecular payloads in ... and rabies targeting genes. Recombinases Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral ...pAAV-CaMKIIa-Flpo None No Single recombinase-dependent Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral ... Dual recombinase-dependent: Fluorophores Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral ... Cre Yes Dual recombinase-dependent: GECI Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral ... recombinase-dependent: Excitatory Opsins Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral ... recombinase-dependent: Inhibitory Opsins Addgene ID Plasmid Logic Sites and Mutations In-Stock Viral ...

  29. Luciferase Plasmid Collection

    Type
    Collection
    ...within the luciferase gene allow for increased copy number in E. coli and expression of luciferase in the ...plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s) Description PI 64784 pGL3...preparations of select luciferase expression plasmids. ID Plasmid Luciferase Type Promoter Description PI 60226...that contains your regulatory element of interest. ID Plasmid Description Gene/Insert PI Return to Top ...

  30. Rett Syndrome

    Type
    Collection
    ...further downstream in the NID and C-terminus. A large number of mutations are known to cause Rett syndrome, ...bacterial) Insert species (mouse or human) Mutation ID Plasmid Description Gene/Insert Mutations PI Return...
Showing: 1 - 30 of 33 results