Skip to main content

We narrowed to 108 results for: EGF

Showing: 1 - 20 of 108 results
  1. Exploring Applications of the Bioluminescent HiBiT Tag

    Type
    Blog Post
    ...to track the internalization of EGFR in real time treatment with EGF. Due to the lack of membrane permeability...-dependent response to EGF (Promega, 2025). The value of HiBiT in these experiments was the ability to...only binds HiBiT still present on the cell surface. EGF treatment resulted in rapid internalization and diminished...-in HiBiT-tagged EGFR cells allowed researchers to track endogenous activity of EGFR, including dose-dependent...receptor dynamics at the cell surface. Find HiBiT-EGFR and EGFR-HiBiT Fusion Vectors at Addgene! Measuring messengers...endothelial growth factor A (VEGF-A) is one of these challenging proteins. VEGF-A mediates angiogenesis through..., exploring the binding kinetics of the VEGF-A and the VEGFR2-NRP1 heteromer (Peach et al., 2021). They...
  2. Four Base Editing Reporters to Monitor and Enrich Editing in Real-time

    Type
    Blog Post
    ...three inactivated eGFP reporters- eGFP L202, eGFP L138, and eGFP L93. The modified eGFPs were placed downstream...comparing cells expressing only eGFP expression to cells expressing eGFP and mCherry. ACE was used to identify... To create the eGFP reporters the Harris lab individually mutated three codons in eGFP to eliminate fluorescence...editisome complexes. The eGFP reporters rely on the correction of point mutations in eGFP that results in the...mutated mCherry and a downstream constitutively active eGFP. To create the inactive mCherry, the lab introduced...fluorescence to monitor APOBEC-Cas-9 mediated editing. eGFP reporters for single base editing by APOBEC-Cas9...previous reporter, the Harris Lab created a panel of eGFP reporters to quantify the on-target DNA editing ...
  3. When is a Monomer not a Monomer? The Top Three Ways Your Favorite Fluorescent Protein Oligomerizes in Cells

    Type
    Blog Post
    ...remain unaware that EGFP/GFP is prone to forming noncovalent dimers. This property of EGFP can lead to significant...The Kd of EGFP is 0.11 mM [2]. Following the simple logic outlined above, you might think EGFP is unlikely..., cyan and yellow variants of EGFP equally capable of dimerizing as EGFP. As a result, CFP and YFP dimers...contributed by guest blogger Erik L. Snapp. Stop using EGFP/GFP for fusion proteins! Despite multiple studies...protein or Enhanced Green Fluorescent Protein (GFP/EGFP) for a transcriptional reporter or as a general ...using a tag with a serious drawback. The standard EGFP plasmid that used to be sold by Clontech and is ... in the world, is not inert. In all seriousness, EGFP/GFP has a real nontrivial propensity to noncovalently...
  4. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ...vector also encodes for eGFP, which serves as a transduction reporter. Note that eGFP is not fused to CD45...-Cy7. Next comes our transduction reporter, eGFP. As eGFP emits fluorescence by itself and does not need...cytometer which channel to use to detect eGFP. As you saw in Figure 4, eGFP strongly overlaps with FITC, hence.... Figure 4 compares the spectra of enhanced GFP (eGFP) and FITC, the latter being a commonly used fluorophore...two compounds are completely different in nature (eGFP being a protein and FITC an organic molecule), their... Figure 4: Excitation and emission spectra for eGFP and FITC. As these fluorophores' spectra virtually...expression) and assess our transduction efficiency (eGFP expression).     The first item in Table 2 is a...
  5. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...our entire AAV inventory. Our new AAVs include: EGFP-expressing AAV for serotype testing Calcium sensors... testing AAV, which are small (20 ul) samples of EGFP-expressing AAV packaged in various serotypes. This...complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available as 20 ul aliquots...recently released these controls: pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad...broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE (51502-AAV5): The CAG promoter directs ubiquitous expression...interneurons. pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a promoter...mCherry in the absence of Cre, and expresses nuclear EGFP in the presence of Cre. Biosensor AAV (calcium ...
  6. Tips for CRISPR Gene Editing in Mice

    Type
    Blog Post
    ...fluorescent protein (EGFP) reconstitution. (a) Scheme of validation for DSB mediated EGFP expression cassette...halves of EGFP to recombine by homology directed repair, and resulting in the expression of EGFP. Using ...strand annealing) took place and reconstituted the EGFP expression cassette. (b) pCAG-EGxxFP target plasmid...pCAG-EGxxFP target plasmid contains overlapping 5′ and 3′ EGFP fragments under the ubiquitous CAG promoter. The...can be placed in multi-cloning site (MCS) between EGFP fragments. The pX330 plasmid contains humanized ...indicates where your target is inserted, disrupting the EGFP fluorescent signal, for details on this plasmid,...
  7. Magnetic Control of Proteins: More than a Dream

    Type
    Blog Post
    ...protein they tested — E. coli expressing good ol’ EGFP — showed a slight but detectable change in fluorescence...better, multiple other labs have reproduced their EGFP findings since the initial report in 2023.)   ...   Figure 1: Fluorescence intensity of EGFP-FlavinTag in E. coli changes in response to a ~25 mT...proteins display a similar effect (many do). Fusing EGFP to the self-labeling FlavinTag made a reliable one-component... the proteins that had shown magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random... semi-random mutagenesis and screening, the EGFP and mScarlet variants were showing no obvious signs of...
  8. Fluorescent Proteins 101: Green Fluorescent Protein (GFP)

    Type
    Blog Post
    ...Find FRET plasmids here. Split EGFP: An alternative to FRET, split EGFP has also been used to study protein-protein...Fluorescent Protein Mutations Relative to Wildtype GFP EGFP F64L; S65T EYFP S65G; V68L; S72A; T203Y mYFP...protein-protein interactions. In this case, two portions of EGFP are fused to the proteins of interest, and when ...they come into close proximity, the two halves of EGFP undergo folding, maturation, and fluorescence. Biosensors... egfp...
  9. Plasmids 101: How to Name Your Plasmid in 3 Easy Steps

    Type
    Blog Post
    ...pBACKBONE-Flag-hGene(Q295A)-EGFP  Wildtype version: pBACKBONE-Flag-hGene-EGFP or pBACKBONE-Flag-hGene(wt)-EGFP These simple...first. pBACKBONE-Flag-hGene If there was also an EGFP fused to the C-terminal of your insert you would...would list it after the insert. pBACKBONE-Flag-hGene-EGFP Other considerations  If your insert contains a ...
  10. Sequencing Primers

    Type
    Guide
    ...early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...factor-1α promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG 3' end of EGFP Forward EGFP-N CGTCGCCGTCCAGCTCGACCAG...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse EXFP-R GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse...CGTCGCCGTCCAGCTCGACCAG 5' end of EGFP Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT...
  11. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor AAV...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype... Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO mCherry ...
  12. New and Upcoming Viral Vectors - June 2019

    Type
    Blog Post
    ... Plasmid Serotype Name 105530  AAV1 pAAV.CMV.PI.EGFP.WPRE.bGH 37825  AAV1 pAAV-CAG-GFP 59462  AAV2...50465 AAV8, 9 (20 µL size serotype testing) AAV-hSyn-EGFP Biosensor AAV The ability to detect the neurotransmitters...Name 119741  AAV5  AAV SYN flex PSAM4 GlyR IRES EGFP Recombinase AAV Finally, we are excited to add...2, 5, rg (20 µL size serotype testing) pAAV-hSyn-EGFP Recombinases Plasmid Serotype Name 55634...Serotype Name 119472  AAV5  AV SYN PSAM4 GlyR IRES EGFP   Biosensors Plasmid Serotype Name 105322...
  13. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...Addgene cloned EGFP into pAG Lenti CMV N-HA Puro (Addgene #236079) to create pAG Lenti CMV HA-EGFP Puro (Addgene...excited to share our very own set of empty, HA-, and EGFP-expressing lentiviral backbones designed right here... packaging and strong expression after inserting EGFP and provide step-by-step protocols for viral generation...Figure 2). Looking for more? Explore our empty and EGFP retroviral plasmid set, our bacterial plasmid set...
  14. New Viral Vectors - Winter 2025

    Type
    Blog Post
    ...Recombinase Ian Wickersham New viral prep pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 AAV2 Recombinase James M. ... prep AiP14033: pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) AAV-PHPeB Optogenetics... prep AiP14035: pAAV-AiE0452h_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4035) AAV-PHPeB Optogenetics... prep AiP15140: pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5140) AAV-PHPeB Optogenetics...
  15. Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System

    Type
    Blog Post
    ...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...unstable, it will be degraded, leading to reduced eGFP fluorescence. Cells expressing the library are then...fluorescence-activated cell sorting into four bins based on their eGFP:mCherry ratios. Genomic DNA from each bin are then extracted...
  16. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    .... Some proteins are reversibly switchable (e.g. rsEGFP, Dreiklang). Fluorescent Timers (FT): These proteins... by the temperature. For instance, enhanced GFP (EGFP) was optimized for 37°C, and is therefore most suited...many cases the brightness is compared to that of EGFP which is set as 1. Some proteins are very dim (e.g...Fluorescence Spectrum Viewer  from BD bioscience. ilovegfp – a site with very comprehensive data sheets on...
  17. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...along with EGFP while retaining an emission spectrum that is easily separable from that of EGFP. This makes...spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and empty vectors that...and combined it with a variety of reporters (i.e. eGFP) and effectors (i.e. DREADDs). The team demonstrated...mCyFP1, the Lin and Yasuda groups use both mCyFP1 and EGFP as FRET donors in experiments simultaneously measuring...
  18. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...necessary to generate the strictly monomeric EGFP variant, mEGFP (Zacharias et al., 2002). GFP needs oxygen...variants. Here I use the name ‘GFP’, which refers to mEGFP. This variant was made by introducing two mutations...original jellyfish GFP (AvGFP) to create enhanced GFP (EGFP), a variant with improved brightness (Tsien, 1998...
  19. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...) Vlatka Zoldoš’ lab has deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted cytosine methylation...methylation in mammalian cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced...Goodell's lab has deposited pcDNA3.1-dCas9-MQ1(Q147L)-EGFP, a fusion of dCas9 to a small DNA methyltransferase...epigenome-editing tools. pLV hUbC-dCas9-MQ1(Q147L)-EGFP is also available for lentiviral transduction. Lysine-specific...
  20. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ...Over-production of vascular endothelial growth factors (VEGF) in tumors is attributed to a signaling cascade,...factor (HIF-1), which promotes the production of VEGF to increase angiogenesis around the tumor. This ...monoclonal antibodies targeting the PD-L1 pathway, VEGF production, and CTLA4 and CD protein blocking. Other...targets under research include TIM-3, LAG-3, STAT-3, EGFR, CD20 and CD73 on specific solid as well as blood-based...
Showing: 1 - 20 of 108 results