We narrowed to 28 results for: MBP
-
TypeBlog Post... from solution. MBP antibodies are available for detection and/or purification of MBP-tagged proteins....Maltose binding protein Maltose binding protein (MBP) is a 45 kDa tag which can be purified (along with...with its fusion protein) with amylose resin. The MBP tag, although large, can actually increase expression...which can be isolated with glutathione resin. Like MBP, it can be removed via protease cleavage at sites...sites immediately following the tag. Unlike MBP, the GST tag can be cleaved off from the fusion protein while...fusion proteins from being purified by GST (maybe try MBP if you are having solubility issues!). Need a GST...
-
In Vivo Biotinylation of Bacterial Fusion Proteins
TypeBlog Post...interest fused to maltose binding protein (MBP, New England BioLabs). MBP has a similar function as GST in that...the fusion protein from a bacterial extract. The MBP tag can be removed using Xa protease. The carboxyl-terminus...AB3596) and mouse (NEB, E8032S) antibodies against MBP are commercially available. Factor Xa loves calcium... -
CRISPRainbow and Genome Visualization
TypeBlog Post...genes over time, at a range of distances from 2-75 Mbp. Labeling multiple, intrachromosomal loci Building...resolved loci with physical map distances of 2 and 75 Mbp, with the calculated fluorescent distances correlating...established physical map. In comparing pairs of targets ~2 Mbp apart, they noticed that they could evaluate the ... -
Mapping the 4D nucleome with CRISPR/Cas9
TypeBlog Post...resolved loci with physical map distances of 75 and 2 Mbp, with the calculated fluorescent distances correlating...established physical map. In comparing pairs of targets ~2 Mbp apart, they noticed that they could evaluate the ... -
Plasmids 101: Protein tags
TypeBlog Post...and stabilization, as can maltose-binding protein (MBP). Overexpression can also lead to insolubility, and... and aggregated protein is not useful protein. MBP tags can help with solubility issues, but scientists...(Bio), flanked by hexahistidine motifs (6xHis) MBP Large Protein 40 Solubility and Purification Can... -
Hot Plasmids - August 2020
TypeBlog Post...peptide of MBP, followed by the desired nanobody (NB) sequence, an AviTAG, and 6xHis tag. The MBP signal ... -
Easing the Protein Purification Process with pCri
TypeBlog Post...enable affinity purification using a Ni-NTA resin. MBP improves protein solubility and stability. TRX and... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...S68TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68300 MBP-MEK1 Plasmid 68299...68283 SepOTSβ Plasmid 53225 MBP-MEK1 S218TAG/S222TAG ( aka. PCRT7 tetR pLtetO MBP-MEK1 XX Amp) Strain 52055... -
Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems
TypeBlog Post...TEV), and C-terminal tags (StrepII, 3xFLAG, 6xHIS, MBP, Myc). These constructs include proteins like nonstructural... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...made by Addgene MBP Protein purification pET28-MBP-TEV - Bacterial expression with MBP-TEV N-terminal ...pDEST Gateway vectors - For the production of His6-MBP-tagged fusion proteins in E. coli SUMO Protein purification... -
Neurodegeneration Plasmid Collection
TypeCollection...Rosenbluh 98651 MBP-FUS_FL_WT FUS His, MBP T7 ALS Nicolas Fawzi 98652 MBP-FUS_FL_12E FUS His, MBP T7 ALS Nicolas...Fawzi 98653 MBP-FUS_LC_WT FUS His, MBP T7 ALS Nicolas Fawzi 98654 MBP-FUS_LC_12E FUS His, MBP T7 ALS Nicolas...98661 MBP-hnRNPA2_LC HNRNPA2B1 His, MBP T7 Multisystem proteinopathy, ALS Nicolas Fawzi 98662 MBP-hnRNPA2...atrophy Greg Matera 38005 pET-21a(+)/MBP-His-PINK1 PINK1 His, MBP T7 Parkinson's Michael J Fox Foundation...PARK7 His T7 Parkinson's Mark Wilson 61090 MBP-mmA1 HNRNPA1 MBP ALS Sean Ryder 61155 C1A-C1A-EYFP PRKCG ...Alzheimer's Thomas Wassmer 69927 pET28-MBP-TEV-AICD APP TEV, MBP T7 Alzheimer's Thomas Wassmer 70625 R777...Nicolas Fawzi 98655 MBP-FUS_FL_6E FUS His, MBP T7 ALS Nicolas Fawzi 98656 FUS_anion FUS T7 ALS Nicolas ... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection... (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5) Mutations Wild ... -
Beyond the Blood Brain Barrier: PHP.B Enters the Central Nervous System Via the LY6A Receptor
TypeBlog Post...related hybrid mice narrowed the search to a ~4.5 Mbp region of the mouse chromosome. Of the genes located... -
Easi-CRISPR: Generating Knock-In and Conditional Mouse Models
TypeBlog Post...Plasmid ID Plasmid Name Tags 69090 pMJ915 MBP (N terminal); 6xHis (N terminal); 2xNLS (C terminal... -
Sequencing Primers
TypeGuide...AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG (Waugh lab) 3' end of ... -
15 Hot Plasmids from 2017
TypeBlog Post...), gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression... -
Bacterial Expression Systems
TypeCollection...Flag, Strep II, c-Myc, HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr, NusA Cleavage sites: TEV protease... -
22 Hot Plasmid Technologies from 2014
TypeBlog Post...including His, S-tag, OneStrep, CBP, Trx, GST, Halo, MBP, NusA and SUMO) for optimizing expression, solubilization... -
Fluorescent Protein Guide: Biosensors
TypeCollection... 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based maltose biosensor A genetically encoded, high-signal-to-noise... -
Twenty Years of Sharing Science!
TypeBlog Post...first request was on September 8, 2004 (for pcDNA-p160MBP, if you're curious.) Since then, we've distributed...