Skip to main content

We narrowed to 58 results for: ef1;

Showing: 1 - 20 of 58 results
  1. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...from the EF1 promoter pCDH-EF1-copGFP 73030 Expresses copGFP from the EF1 promoter pCDH-EF1s-Nluc-P2A-...truncated EF1 promoter pCDH-EF1S-Nluc 73033 Expresses Nluc from a truncated EF1 promoter pCDH-EF1s-copGFP...from the EF1 promoter pAdx-EF1-tdTomato 73354 Expresses tdTomato from the EF1 promoter pICPIS-EF1 73355 ...from the EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter...pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro 73022 Expresses Nluc and copGFP from the EF1 promoter pCDH-EF1-Nluc ...vectors pICPIS-EF1 (Addgene #73355) and pICPIS-CB (Addgene #73356) . pICPIS-EF1 contains the EF1 promoter while...promoter pAdxEF1-FLPe-tdTomato 73352 Expresses FLPe and tdTomato from the EF1 promoter pAdx-EF1-copGFP ...
  2. Sequencing Primers

    Type
    Guide
    ...Xenopus beta-globin 3'UTR Reverse XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer/promoter Forward...
  3. Lentivirus Plasmids

    Type
    Collection
    ...additional selection markers. Tobias Meyer 86849 pBOB-EF1-FastFUCCI-Puro 3rd Encodes FUCCI reporters for cell...
  4. Luciferase Plasmid Collection

    Type
    Collection
    ...promoter Antonius Plagge 72486 pCDH-EF1-Luc2-P2A-tdTomato Firefly EF1α Lentiviral expression of human codon-optimized...Marcel Bruchez 108542 pLenti-EF1a-Luciferase-IRES-Blast-WPRE Firefly EF1α Lentiviral expression of firefly...pC0037 Gaussia, Cypridina EF1α, CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina...backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla EF1α AAV-CRISPR knockout plasmid. Renilla luciferase ...Scott Lowe 105621 Lenti-luciferase-P2A-Neo Firefly EF1α Lentiviral expression of firefly luciferase Christopher... Sam Gambhir 104587 pHIV-iRFP720-E2A-Luc Firefly EF1α Lentiviral expression of firefly luciferase and ...Kazuhiro Oka 118017 pLX313-Firefly luciferase Firefly EF1α Lentiviral expression of firefly luciferase William...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Ferguson 221553 pPB-EF1A-Puro-hTBK1-EGFP TBK1 GFP EF1-alpha ALS Shawn Ferguson 221554 pPB-EF1A-Puro-hTBK1-E696K-EGFP...229738 pPB-EF1A-HALO-hLRRK2 LRRK2 Halo EF1-alpha Parkinson's Shawn Ferguson 229742 pPB-EF1A-HALO-hLRRK2...ALS Michiyuki Matsuda 197908 piggybac-EF1-halo-mTBP TBP Halo EF1a Parkinson's James Zhe Liu 197975 pET-...WEVL -> AEVA) LRRK2 Halo EF1-alpha Parkinson's Shawn Ferguson 229743 pPB-EF1A-HALO-hLRRK2 (LIR2 mutant...WTFI -> ATFA) LRRK2 Halo EF1-alpha Parkinson's Shawn Ferguson 229744 pPB-EF1A-HALO-hLRRK2 (LIR1+2 mutant... 215474 pEF.DEST51-VPS35-mScarlet VPS35 mScarlet EF1-alpha Parkinson's Johanna Ivaska 215486 FUW-hSNCA-NE...E696K-EGFP TBK1 GFP EF1-alpha ALS Shawn Ferguson 221849 eSrtA-delta24-ASN SNCA His, SUMO T7 Parkinson'...
  6. New and Upcoming Viral Vectors - May 2020

    Type
    Blog Post
    ...pLVX-EF1alpha-SARS-CoV-2-N-2xStrep-IRES-Puro: Expression of the SARS-CoV-2 N protein  pLVX-EF1alpha-SARS-CoV...the E protein (pLVX-EF1alpha-SARS-CoV-2-E-2xStrep-IRES-Puro) and NSP2 (pLVX-EF1alpha-SARS-CoV-2-nsp2-2xStrep-IRES-Puro...Depositor 27056 AAVrg pAAV-Ef1a-DIO EYFP Karl Deisseroth 11447 AAV5 pAAV-Ef1a-fDIO mCherry Karl Deisseroth...Depositor 69570 AAV1 pAAV-EF1a-N-CretrcintG Connie Cepko 69571 AAV1 pAAV-EF1a-C-CreintG Connie Cepko ...2xStrep-IRES-Puro: Expression of the SARS-CoV-2 M protein pLVX-EF1alpha-SARS-CoV-2-orf3a-2xStrep-IRES-Puro: Expression...Deisseroth 112677 AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP Brandon Harvey 50457 AAV2 pAAV-hSyn-DIO-EGFP... 75469 AAV1 pAAV-EF1a-Flp-DOG-NW Connie Cepko Viral vectors coming soon! These vectors listed below...
  7. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...AAVrg pAAV-Ef1a-DIO EYFP 114471 AAV5 pAAV-Ef1a-fDIO mCherry 112677 AAV2 pOTTC1032 - pAAV EF1a Nuc-flox...pAAV-Ef1a-fDIO mCherry 99130 AAVrg pAAV-mDlx-NLS-mRuby2 112677 AAV1, AAV2 pOTTC1032 - pAAV EF1a Nuc-flox...dependent. Plasmid Serotype Name 124603 AAV9 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 124650 AAV9...Nuc-flox(mCherry)-EGFP 27056 AAVrg pAAV-Ef1a-DIO EYFP 50457 AAV2 pAAV-hSyn-DIO-EGFP   Biosensor ...GP-AAV-CAG-FLEX-jGCaMP7s-WPRE 105714 AAV8 pAAV-Ef1a-fDIO-GCaMP6s Neurotransmitter sensors: Dopamine... Plasmid Serotype Name 87306 AAVrg, AAV5 AAV pEF1a-DIO-FLPo-WPRE-hGHpA    Additional resources...
  8. New and Upcoming Viral Vectors - September 2019

    Type
    Blog Post
    ...pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a promoter directs...50363-AAV5) Flp vectors pAAV-EF1a-mCherry-IRES-Flpo (55634-AAV1) pAAV-EF1a-Flpo (55637-AAV1) Viral vectors...AAVrg. See our new additions here: Cre vectors pAAV-EF1a-fDIO-Cre (121675-AAV9, 121675-AAVrg)  pENN.AAV.hSyn.Cre.WPRE.hGH...pAAV-hSyn-hChR2(H134R)-mCherry (26976-AAV5) pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5) Calcium Sensors...
  9. New and Upcoming Viral Vectors - June 2019

    Type
    Blog Post
    ...Serotype Name 55637  AAVrg pAAV-EF1a-Flpo 87306  AAV1 AAV pEF1a-DIO-FLPo-WPRE-hGHp Other new viral...Serotype Name 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637  AAV1  pAAV-EF1a-Flpo Chemogenetics Plasmid...-jGCaMP7c variant 1513-WPRE 105714  AAV8  pAAV-Ef1a-fDIO-GCaMP6s Optogenetics Plasmid Serotype...pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 124603  AAV9  pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40  Additional...
  10. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ... Stanley Thomas Carmichael New viral prep pAAV-EF1a-fDIO-Cre AAV5 Recombinases Esteban Engel New serotype...pAAV-CaMKIIa-EGFP AAV1 Controls Bryan Roth New serotype pAAV-Ef1a-DIO mScarlet AAV5 Controls Karl Deisseroth New serotype...AAV1 Optogenetics Edward Boyden New serotype pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE AAV1 Optogenetics Karl...
  11. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ... 121675  AAV9  pAAV-EF1a-fDIO-Cre (FLP-dependent CRE) 55634  AAV1  pAAV-EF1a-mCherry-IRES-Flpo 55637... 55637  AAV1  pAAV-EF1a-Flpo Calcium sensors Plasmid Serotype Name 104496  AAV1  GP-AAV-CAG-FLEX-jGCaMP7f-WPRE...
  12. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...enhancer region. Can be silenced in some cell types. EF1a General expression mRNA Strong mammalian expression...independently or together. Regulated by GAL4 and GAL 80. TEF1 General expression mRNA Yeast transcription elongation...factor promoter Constitutive  Analogous to mammalian EF1a promoter. GDS General expression mRNA  Strong ...
  13. New Viral Vectors - March 2024

    Type
    Blog Post
    ...PHP.eB Controls Wilson New viral vector pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype...AAV PHP.eB Controls Deisseroth New serotype pAAV-Ef1a-mCherry  AAV PHP.eB Controls Deisseroth New serotype...
  14. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...Yizhar New viral service with multiple serotypes pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE AAV1, AAV5 Optogenetics...pAAV-hSyn-GRAB_ACh3.0 AAV9 Biosensors Li New viral service pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New...
  15. New Viral Vectors - Winter 2025

    Type
    Blog Post
    ...AAV1 Biosensor Marianne Fyhn New viral prep pAAV-Ef1a-fDIO EYFP AAV5. AAV8, AAVrg Control Karl Deisseroth...AAV1 Chemogenetics Bryan Roth New serotype pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato AAV8 Molecular tool...
  16. Viral Production at Addgene

    Type
    Blog Post
    ...: AAV Pro cells were transduced with either pAAV-Ef1a-mCherry-IRES-Cre (55634-AAVrg) alone at 1.7E6 viral...Cre. mCherry expression alone was detected. pAAV-Ef1a-mCherry-IRES-Cre was a gift from Karl Deisseroth...
  17. New Viral Vectors - Spring 2025

    Type
    Blog Post
    ...Optogenetics Ofer Yizhar New viral tool pAAV-Ef1a-fDIO hChR2(H134R)-EYFP AAVrg Optogenetics Karl Deisseroth...
Showing: 1 - 20 of 58 results