We narrowed to 257 results for: gfp gene

...check out our article: Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection. Cellular...been generated for yeast (Kim et al., 2019) and fruit flies (Bischof et al., 2018), the generation of such...quantities (and the correct stoichiometric ratios) to generate useable data. What’s more, measuring and quantifying...straightforward nature of BiFC also makes it easier to generate a large number of constructs for high-throughput...screening of PPIs. For example, Bischof et al. (2018) generated an open reading frame (ORF) library to screen ... such resources in less genetically tractable organisms lags behind. BiFC can also be used to screen for...pair. Find BiFC plasmids for your experiment at Addgene! How to Design a BiFC Experiment Much like FRET...

...which must be stabilized by monomeric superfolded GFP and averages only ~50% RNA knockdown. In initial ...plasmids from this paper at Addgene. Additional Resources on the Addgene Blog Check out our CRISPR Featured...and designated this system REPAIRv1. Using next-generation sequencing, they confirmed A->I editing and found...cytosine deaminase. Three rounds of rational mutagenesis on the ADAR2DD residues that contact the RNA ...RNA-sequencing, the authors performed rational mutagenesis and identified that a S375A mutation in RESCUE...PMID: 29070703. Find plasmids from this paper at Addgene. Abudayyeh, Omar O., et al. “RNA targeting with...PMID: 28976959. Find plasmids from this paper at Addgene. Abudayyeh, Omar O., et al. "C2c2 is a single-...

...In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest ...resources on the Addgene blog: Introduction to Immunofluorescence View all of Addgene's antibody posts  ...Resources on Addgene.org: Find plasmids encoding recombinant antibodies at Addgene  ...that interact with nucleic acids. Labs studying epigenetics routinely use the chromatin IP (ChIP) technique... found this blog helpful be sure to check out Addgene’s blog for other antibody topics.     References...

...about the Dangers of Using GFP for Protein Localization Resources on Addgene.org Find Plasmids for Mammalian...pharmacology (many of which are represented in Addgene's Special Collections). Arguably, oncology has benefited...examining whether the cell lines had isoenzymes and genetic polymorphisms specific to their origins. This technique...out by the commercial repository. Repositories generally ensure cell line identity and purity making it...to the original as possible and so any results generated are reproducible and reliable. When you order ...Abcam Cell Culture Guidelines Resources on the Addgene Blog Learn All about Mammalian Vectors Read up...

...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca 2+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP...

...varies across targets, they tested two genes in mice. For both genes, they saw indel formation and phenotypic...in vitro and germline genome editing, but in vivo gene editing approaches have been limited by problems...viral vectors (AAV) are commonly used for in vivo gene delivery due to their low immunogenicity and range...markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs mediate...al. successfully used CjCas9 with AAV to target genes in mouse muscle and eye tissue. Neisseria meningitidis...cell is transduced by both AAVs, the full length gene and/or protein is reconstituted. One way to reconstitute...split intein spCas9-AAV toolbox that retains the gene-targeting capabilities of full-length SpCas9. This...

...vectors that deliver GFP.   Figure 3: A) Cumulative AAV preps available at Addgene from 2016–2023 by...in the Addgene repository each year from 2016–2023. B) AAV preps distributed per year by Addgene from 2016...vector preps contain biosensors, optogenetic tools, and chemogenetic tools: protein tools that are activated...biosensor, by Addgene’s categorization) was first developed in 2001, with successive generations developed...As part of Addgene’s 20th anniversary celebration, we’ve been finding and sharing stories unique to our... our repository and resources. As editor of Addgene’s eBooks — including the recently released Viral Vectors...viruses engineered to be safely used to deliver a genetic payload to cells, and the complexity of effectively...

...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone...If you’re been following Addgene on #souptwitter or if you just enjoy a warm meal on a winter day, you...molecule into the cell. The fluorescence that is generated allows for qualitative and quantitative measurement...placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the... we’ll take a deeper dive into the content of Addgene’s aptamer soup by exploring the development and ...and applications of fluorescent RNA aptamers in Addgene’s collection. Green fluorescent aptamers Spinach...s group created Spinach2 using site-directed mutagenesis of Spinach. In doing so, they identified the ...

...express first with a control reporter gene: GFP for E. coli or mCherry-GFP for mammalian cells. You should ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR). ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR) and...contain genes with modified codons for non-canonical amino acid incorporation. ID Plasmid Gene/Insert ...Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant inactivated...

...Explore Addgene's collection of luciferase plasmids for gene expression assays and bioluminescent reporters...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...luciferase-containing plasmid and the effects on gene expression can be measured by the luminescence output...into which you can clone your regulatory element or gene of interest into to create a luciferase reporter...Firefly, Renilla Creating ORF-Firefly luciferase gene fusions. Renilla luciferase under the control of...enhancer regions. Mutations within the luciferase gene allow for increased copy number in E. coli and expression... Retroviral expression of firefly luciferase and gene of interest Scott Lowe 21375 pHIV-Luciferase Firefly...

...transcription factor collection that contains 1,836 genes encoded by 3,548 isoforms and two control vectors...10X scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled library is...transcription factor open reading frames with or without GFP and mCherry controls. Do you have suggestions for... transcription factor collection, available at Addgene. The collection can be used for screening transcription... entire pooled collection, can be purchased at Addgene. Each transcription factor isoform has a unique...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...an unpublished set of Zika gene plasmids to Addgene’s repository. The genes, from the Zika virus Asian...vectors targeting their genes of interest to generate mAID fusions to endogenous genes. Cell lines with the...targeting a total of 20,121 genes within the human genome (the identity of the genes and target sequences can...expression level for their gene of interest. Although the parts involved in altering gene expression are relatively...promoters and 140 genes, including constructs with unique tissue-specific promoters expressing GFP, tetracycline...contains ~90,000 gRNAs that target ~15,000 genes with 6 gRNAs per gene. The second is a "supplementary" library...library to generate a population of HEK293FT cells expressing a single gRNA targeting a single gene. The gRNA...

...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top CRISPR Resources Addgene has ... Cas9 (dCas9) fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...Additional Resources on the Addgene Blog Treating Muscular Dystrophy with CRISPR Gene Editing Learn to Use ...activated HIV-1, measured via HIV-1 promoter-driven GFP expression. In cell lines that can produce HIV-1 ...Cas9 have also been used to create mutations in genes essential to HIV-1 replication. However, this approach...modification targeting either the LTRs or essential genes. Many of these escape mutations were located near...Genomes from Human T-lymphoid Cells by CRISPR/Cas9 Gene Editing. Sci Rep. 2016 Mar 4;6:22555. PubMed PMID...Screens Additional Resources onf Addgene.org Check out Addgene’s newly updated CRISPR Guide! Find CRISPR...Activation Mediators (SAM) system available from Addgene. This system uses the dCas9-VP64 fusion commonly...

...may be the hot new way to manipulate gene expression, but other gene manipulation systems remain valuable...important ways to spatially and temporally control gene expression, especially in in vivo models, and new...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully generated custom antibodies to...-2. The general structure of Brainbow-1.0 is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2...at least six generations. In addition to the neuronal pThy1-Brainbow constructs, Addgene also has two ...Brainbow plasmids available from Addgene! Find Brainbow Plasmids @Addgene: Brainbow 1.0, 1.1, 2.1 plasmids...

...listed below. When targeting other gene loci, you will prepare the gene-specific CRISPR and donor vectors...FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen...multiple genes. Plasmids can be found associated with the following article: Paix, et al. Genetics 2014 Allen...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...repair template design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System ... the plasmids as listed in each row. If your own gene of interest is currently unavailable, you will need...terminal affinity tag (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This...

...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins...Browse Addgene's collection of recombinant monoclonal antibodies. Antibodies...Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal antibodies undergo application-specific...application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this...antibodies currently available from our catalog. Addgene values transparency and accessibility in research...reactivity. Reactivity is based on validation data from Addgene or trusted partner labs or is predicted based on... on sequence homology with the antigen. Addgene supplies a list of recommended applications based on our...

...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Reverse CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward...CCCAGTCACGACGTTGTAAAACG In lacZ gene Foward M13/pUC Reverse AGCGGATAACAATTTCACACAGG In lacZ gene Reverse MSCV Forward...TGTAAAACGACGGCCAGT In lacZ gene Forward M13 Forward (-40) GTTTTCCCAGTCACGAC In lacZ gene Forward M13 Reverse ...CAGGAAACAGCTATGAC In lacZ gene Reverse M13/pUC Forward CCCAGTCACGACGTTGTAAAACG In lacZ gene Forward M13/pUC Reverse...neomycin resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F...puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance gene Reverse pZIP...

...Figure 1: MTRIA biosensors are generated by inserting a circularly-permuted GFP into an intracellular loop...new to Addgene this year. Feel the love with MTRIA sensors One of the latest additions to Addgene’s catalog...imaging. Vladislav Verkhusha’s lab has generated a new genetically encoded calcium indicator using small...on the Addgene blog Fluorescent Proteins 101: Fluorescent Biosensors Resources on Addgene.org Fluorescent...Here at Addgene’s headquarters, the skies are getting dark and wintry with the end of year approaching...localized for synaptic glutamate response. They generated variants optimized for different applications ...St-Pierre lab and colleagues have developed a new genetically-encoded voltage indicator (GEVI) called JEDI-...

...reporters simultaneously. By fusing sfGFP and/or mCherry to genes of interest, it is thus possible to ...to bind on the chromosome. When dCas9 binds to a gene, it blocks the progression of the RNA polymerase...enables robust, noiseless knockdown of bacterial genes. Molecular Systems Biology, 14(3):e7899. doi: 10.15252... CRISPR knockdown to modulate expression of two genes without cross‐talk. (A) Schematic of the strain ... the tracrRNA sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting...carrying two CRISPR guides. The first one binds to sfgfp with either 0, 10, 11, 14, or 20 matching nucleotides...sites. The levels of the two reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐...