Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 260 results for: gfp gene

Showing: 181 - 200 of 260 results

  1. Chemogenetics AAV Preps

    Type
    Collection
    ... 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent 1 Sternson 154867 pAAV-hSyn-fDIO-hM4D...Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics AAV Use our chemogenetics AAV to chemically...IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4...Ready-to-use AAV available from Addgene's viral service encoding chemogenetics tools. Viral...in specific cell types. See our Chemogenetics Plasmids and Chemogenetics Guide pages for more information...119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Sternson 119742... Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre...

  2. Tetracycline Inducible Expression

    Type
    Collection
    ...promoter upstream of your gene of interest. If your gene of interest should be generally active and only turned...Iwasato 63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase...Tet-On Systems for Doxycycline-inducible Gene Expression . Curr Gene Ther, 16 (3), 156–167. https://doi.org...Tet-On system for regulated gene expression through viral evolution . Gene Ther, 13 (19), 1382–1390. https...downstream gene via its activation domain than simply removing the repressor. 2nd and 3rd Generation Systems...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...

  3. Bacterial Expression Systems

    Type
    Collection
    ...knocking out genes or introducing specific mutations can reveal important insights into gene function. These...Vladislav Verkhusha 52732 52733 pET11a-link-NGFP pMRBAD-link-CGFP GFP (reconstructed) BiFC Lynne Regan 168257... mammalian cells. Addgene Blog A Guide to Selecting Fluorescent Dyes and Ligands GFP Fusion Proteins —...expression of a gene of interest in E. coli . The Marionette Sensor Collection (Addgene #1000000137) allows...of up to twelve genes using small-molecule inducers in the same E. coli strain. Addgene Blog Inducible ...Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity Fluorescence (GFPuv) Gram-negative...bacterial gene biology or engineering metabolic pathways to synthesize a target metabolite, genetic tools ...

  4. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...varies across targets, they tested two genes in mice. For both genes, they saw indel formation and phenotypic...in vitro and germline genome editing, but in vivo gene editing approaches have been limited by problems...viral vectors (AAV) are commonly used for in vivo gene delivery due to their low immunogenicity and range...markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs mediate...al. successfully used CjCas9 with AAV to target genes in mouse muscle and eye tissue. Neisseria meningitidis...cell is transduced by both AAVs, the full length gene and/or protein is reconstituted. One way to reconstitute...split intein spCas9-AAV toolbox that retains the gene-targeting capabilities of full-length SpCas9. This...

  5. Twenty Years of Sharing: Addgene's Viral Vector Service

    Type
    Blog Post
    ...vectors that deliver GFP.   Figure 3: A) Cumulative AAV preps available at Addgene from 2016–2023 by...in the Addgene repository each year from 2016–2023. B) AAV preps distributed per year by Addgene from 2016...vector preps contain biosensors, optogenetic tools, and chemogenetic tools: protein tools that are activated...biosensor, by Addgene’s categorization) was first developed in 2001, with successive generations developed...As part of Addgene’s 20th anniversary celebration, we’ve been finding and sharing stories unique to our... our repository and resources. As editor of Addgene’s eBooks — including the recently released Viral Vectors...viruses engineered to be safely used to deliver a genetic payload to cells, and the complexity of effectively...

  6. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP...

  7. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone...If you’re been following Addgene on #souptwitter or if you just enjoy a warm meal on a winter day, you...molecule into the cell. The fluorescence that is generated allows for qualitative and quantitative measurement...placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the... we’ll take a deeper dive into the content of Addgene’s aptamer soup by exploring the development and ...and applications of fluorescent RNA aptamers in Addgene’s collection. Green fluorescent aptamers Spinach...s group created Spinach2 using site-directed mutagenesis of Spinach. In doing so, they identified the ...

  8. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13/pUC...Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG...resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, reverse ...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine...ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...

  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...an unpublished set of Zika gene plasmids to Addgene’s repository. The genes, from the Zika virus Asian...vectors targeting their genes of interest to generate mAID fusions to endogenous genes. Cell lines with the...targeting a total of 20,121 genes within the human genome (the identity of the genes and target sequences can...expression level for their gene of interest. Although the parts involved in altering gene expression are relatively...promoters and 140 genes, including constructs with unique tissue-specific promoters expressing GFP, tetracycline...contains ~90,000 gRNAs that target ~15,000 genes with 6 gRNAs per gene. The second is a "supplementary" library...library to generate a population of HEK293FT cells expressing a single gRNA targeting a single gene. The gRNA...

  10. Genetic Code Expansion

    Type
    Collection
    ...express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR). ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR) and...Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant inactivated...that contain genes with modified codons for unnatural amino acid incorporation. ID Plasmid Gene/Insert Vector...

  11. Targeting HIV-1 with CRISPR: Shock and Kill or Cut it Out?

    Type
    Blog Post
    ...Additional Resources on the Addgene Blog Treating Muscular Dystrophy with CRISPR Gene Editing Learn to Use ...activated HIV-1, measured via HIV-1 promoter-driven GFP expression. In cell lines that can produce HIV-1 ...Cas9 have also been used to create mutations in genes essential to HIV-1 replication. However, this approach...modification targeting either the LTRs or essential genes. Many of these escape mutations were located near...Genomes from Human T-lymphoid Cells by CRISPR/Cas9 Gene Editing. Sci Rep. 2016 Mar 4;6:22555. PubMed PMID...Screens Additional Resources onf Addgene.org Check out Addgene’s newly updated CRISPR Guide! Find CRISPR...Activation Mediators (SAM) system available from Addgene. This system uses the dCas9-VP64 fusion commonly...

  12. Luciferase Plasmid Collection

    Type
    Collection
    ...Explore Addgene's collection of luciferase plasmids for gene expression assays and bioluminescent reporters...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...luciferase-containing plasmid and the effects on gene expression can be measured by the luminescence output...into which you can clone your regulatory element or gene of interest into to create a luciferase reporter...Firefly, Renilla Creating ORF-Firefly luciferase gene fusions. Renilla luciferase under the control of...enhancer regions. Mutations within the luciferase gene allow for increased copy number in E. coli and expression... Retroviral expression of firefly luciferase and gene of interest Scott Lowe 21375 pHIV-Luciferase Firefly...

  13. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ...may be the hot new way to manipulate gene expression, but other gene manipulation systems remain valuable...important ways to spatially and temporally control gene expression, especially in in vivo models, and new...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully generated custom antibodies to...-2. The general structure of Brainbow-1.0 is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2...at least six generations. In addition to the neuronal pThy1-Brainbow constructs, Addgene also has two ...Brainbow plasmids available from Addgene! Find Brainbow Plasmids @Addgene: Brainbow 1.0, 1.1, 2.1 plasmids...

  14. Lentivirus Plasmids

    Type
    Collection
    ...viral particle) and toxicity of the gene product (i.e., if the gene encoded by the transfer plasmid is ...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...promoter for transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. ...24129 pULTRA 3rd bi-cistronic expression of EGFP and the gene of interest, also can express shRNA (cloning... which can be modified to encode a wide range of gene products. The main restrictions on a lentiviral ...chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid. Nolan...gateway plasmid, constitutive Hygromycin resistance gene coexpression. See article for other versions of ...

  15. Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection

    Type
    Collection
    ...transcription factor collection that contains 1,836 genes encoded by 3,548 isoforms and two control vectors...10X scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled library is...transcription factor open reading frames with or without GFP and mCherry controls. Do you have suggestions for... transcription factor collection, available at Addgene. The collection can be used for screening transcription... entire pooled collection, can be purchased at Addgene. Each transcription factor isoform has a unique...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

  16. Hot Biosensors 2022: Year-End Roundup

    Type
    Blog Post
    ...Figure 1: MTRIA biosensors are generated by inserting a circularly-permuted GFP into an intracellular loop...new to Addgene this year. Feel the love with MTRIA sensors One of the latest additions to Addgene’s catalog...imaging. Vladislav Verkhusha’s lab has generated a new genetically encoded calcium indicator using small...on the Addgene blog Fluorescent Proteins 101: Fluorescent Biosensors Resources on Addgene.org Fluorescent...Here at Addgene’s headquarters, the skies are getting dark and wintry with the end of year approaching...localized for synaptic glutamate response. They generated variants optimized for different applications ...St-Pierre lab and colleagues have developed a new genetically-encoded voltage indicator (GEVI) called JEDI-...

  17. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ... Cas9 (dCas9) fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable... throughout the chromosome. Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

  18. CRISPR Plasmids - Tagging

    Type
    Collection
    ...listed below. When targeting other gene loci, you will prepare the gene-specific CRISPR and donor vectors...FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen...multiple genes. Plasmids can be found associated with the following article: Paix, et al. Genetics 2014 Allen...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...repair template design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System ... the plasmids as listed in each row. If your own gene of interest is currently unavailable, you will need...terminal affinity tag (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This...

  19. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...possible deletion strategies for genes and non-coding elements. For creating a gene knockout, two sgRNA located...evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene 7,8 . To evaluate the protein, perform...genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple... as pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP and puromycin...for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines. Protocol...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...filter into a FACS tube. FACS sort the top ~3% of GFP positive cells in order to enrich for cells that ...

  20. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ... transcription of a target gene, it therefore determines the timing of gene expression and largely defines...These permit exquisite control of gene expression and tracing of gene expression across development. One...of herpes simplex virus immediate early gene expression. Genes Dev. 1988 Jun;2(6):718-29. doi: 10.1101...systems are genetic tools that consist of two parts, both of which must be present for a gene of interest...placing UAS upstream of a transgene permits directed expression of that gene in cells that also express...expression of reporter genes, or to combine reporter expression from one promoter with transgene or siRNA expression...together for complex genetic analysis in Drosophila or for precise control over multiple genes in synthetic systems...
Showing: 181 - 200 of 260 results