...In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest ...resources on the Addgene blog: Introduction to Immunofluorescence View all of Addgene's antibody posts  ...Resources on Addgene.org: Find plasmids encoding recombinant antibodies at Addgene  ...that interact with nucleic acids. Labs studying epigenetics routinely use the chromatin IP (ChIP) technique... found this blog helpful be sure to check out Addgene’s blog for other antibody topics.     References...

...about the Dangers of Using GFP for Protein Localization Resources on Addgene.org Find Plasmids for Mammalian...pharmacology (many of which are represented in Addgene's Special Collections). Arguably, oncology has benefited...examining whether the cell lines had isoenzymes and genetic polymorphisms specific to their origins. This technique...out by the commercial repository. Repositories generally ensure cell line identity and purity making it...to the original as possible and so any results generated are reproducible and reliable. When you order ...Abcam Cell Culture Guidelines Resources on the Addgene Blog Learn All about Mammalian Vectors Read up...

...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...

...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ... information, please visit the Addgene SAM library page . Targeted gene activation using SAM There are...available for mammalian endogenous gene activation using SAM: Addgene plasmids #61422 - #61424 were designed...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically...human codon-optimized, and packages both the SaCas9 gene and its single guide RNA (sgRNA) into one plasmid...

...varies across targets, they tested two genes in mice. For both genes, they saw indel formation and phenotypic...in vitro and germline genome editing, but in vivo gene editing approaches have been limited by problems...viral vectors (AAV) are commonly used for in vivo gene delivery due to their low immunogenicity and range...markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs mediate...al. successfully used CjCas9 with AAV to target genes in mouse muscle and eye tissue. Neisseria meningitidis...cell is transduced by both AAVs, the full length gene and/or protein is reconstituted. One way to reconstitute...split intein spCas9-AAV toolbox that retains the gene-targeting capabilities of full-length SpCas9. This...

...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-.../22R] Prrt2 Mouse Mouse IgG2a 188166 Anti-GFP [N86/20R] GFP Aequorea victoria Mouse IgG2a 188167 Anti-...

...vectors that deliver GFP.   Figure 3: A) Cumulative AAV preps available at Addgene from 2016–2023 by...in the Addgene repository each year from 2016–2023. B) AAV preps distributed per year by Addgene from 2016...vector preps contain biosensors, optogenetic tools, and chemogenetic tools: protein tools that are activated...biosensor, by Addgene’s categorization) was first developed in 2001, with successive generations developed...As part of Addgene’s 20th anniversary celebration, we’ve been finding and sharing stories unique to our... our repository and resources. As editor of Addgene’s eBooks — including the recently released Viral Vectors...viruses engineered to be safely used to deliver a genetic payload to cells, and the complexity of effectively...

...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone...If you’re been following Addgene on #souptwitter or if you just enjoy a warm meal on a winter day, you...molecule into the cell. The fluorescence that is generated allows for qualitative and quantitative measurement...placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the... we’ll take a deeper dive into the content of Addgene’s aptamer soup by exploring the development and ...and applications of fluorescent RNA aptamers in Addgene’s collection. Green fluorescent aptamers Spinach...s group created Spinach2 using site-directed mutagenesis of Spinach. In doing so, they identified the ...

...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology SNAP-tag...England Biolabs has deposited plasmids at Addgene to generate SNAP, CLIP, ACP or MCP tagged plasmids for...associated with this technology are available at Addgene for distribution to the research community. Key...synthases needed for use of these tags. Plasmids Addgene ID Plasmid Substrate Feature 101137 pSNAP-tag (...and the ACP and SFP Synthases. Users may still generate their own fluorescent or non-fluorescent CoA substrates...

... 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent 1 Sternson 154867 pAAV-hSyn-fDIO-hM4D...Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics AAV Use our chemogenetics AAV to chemically...IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4...Ready-to-use AAV available from Addgene's viral service encoding chemogenetics tools. Viral...in specific cell types. See our Chemogenetics Plasmids and Chemogenetics Guide pages for more information...119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Sternson 119742... Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre...

...an unpublished set of Zika gene plasmids to Addgene’s repository. The genes, from the Zika virus Asian...vectors targeting their genes of interest to generate mAID fusions to endogenous genes. Cell lines with the...targeting a total of 20,121 genes within the human genome (the identity of the genes and target sequences can...expression level for their gene of interest. Although the parts involved in altering gene expression are relatively...promoters and 140 genes, including constructs with unique tissue-specific promoters expressing GFP, tetracycline...contains ~90,000 gRNAs that target ~15,000 genes with 6 gRNAs per gene. The second is a "supplementary" library...library to generate a population of HEK293FT cells expressing a single gRNA targeting a single gene. The gRNA...

...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP...

...Additional Resources on the Addgene Blog Treating Muscular Dystrophy with CRISPR Gene Editing Learn to Use ...activated HIV-1, measured via HIV-1 promoter-driven GFP expression. In cell lines that can produce HIV-1 ...Cas9 have also been used to create mutations in genes essential to HIV-1 replication. However, this approach...modification targeting either the LTRs or essential genes. Many of these escape mutations were located near...Genomes from Human T-lymphoid Cells by CRISPR/Cas9 Gene Editing. Sci Rep. 2016 Mar 4;6:22555. PubMed PMID...Screens Additional Resources onf Addgene.org Check out Addgene’s newly updated CRISPR Guide! Find CRISPR...Activation Mediators (SAM) system available from Addgene. This system uses the dCas9-VP64 fusion commonly...

...may be the hot new way to manipulate gene expression, but other gene manipulation systems remain valuable...important ways to spatially and temporally control gene expression, especially in in vivo models, and new...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully generated custom antibodies to...-2. The general structure of Brainbow-1.0 is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2...at least six generations. In addition to the neuronal pThy1-Brainbow constructs, Addgene also has two ...Brainbow plasmids available from Addgene! Find Brainbow Plasmids @Addgene: Brainbow 1.0, 1.1, 2.1 plasmids...

...Figure 1: MTRIA biosensors are generated by inserting a circularly-permuted GFP into an intracellular loop...new to Addgene this year. Feel the love with MTRIA sensors One of the latest additions to Addgene’s catalog...imaging. Vladislav Verkhusha’s lab has generated a new genetically encoded calcium indicator using small...on the Addgene blog Fluorescent Proteins 101: Fluorescent Biosensors Resources on Addgene.org Fluorescent...Here at Addgene’s headquarters, the skies are getting dark and wintry with the end of year approaching...localized for synaptic glutamate response. They generated variants optimized for different applications ...St-Pierre lab and colleagues have developed a new genetically-encoded voltage indicator (GEVI) called JEDI-...

... transcription of a target gene, it therefore determines the timing of gene expression and largely defines...These permit exquisite control of gene expression and tracing of gene expression across development. One...of herpes simplex virus immediate early gene expression. Genes Dev. 1988 Jun;2(6):718-29. doi: 10.1101...systems are genetic tools that consist of two parts, both of which must be present for a gene of interest...placing UAS upstream of a transgene permits directed expression of that gene in cells that also express...expression of reporter genes, or to combine reporter expression from one promoter with transgene or siRNA expression...together for complex genetic analysis in Drosophila or for precise control over multiple genes in synthetic systems...

...express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR). ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR) and...Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant inactivated...that contain genes with modified codons for unnatural amino acid incorporation. ID Plasmid Gene/Insert Vector...

... bright enough to detect endogenous tagged genes generated through CRISPR/Cas9 knock-in. Finally, NLuc...Fusion Protein, codon-optimized Firefly luciferase genes (e.g., luc2), and NanoLuc® Luciferase are available...fluorescent protein that could be co-imaged with GFP using the same wavelength for excitation. The result...such as the dynamics of subcellular structures and gene expression. You must see the movies demonstrating...al. (2016) CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nature...when employing optogenetic regulators to initiate the event being monitored. Optogenetic regulators respond...wavelengths overlap with optogenetic initiation wavelengths, excitation of the optogenetic regulator leads to...

...transcription factor collection that contains 1,836 genes encoded by 3,548 isoforms and two control vectors...10X scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled library is...transcription factor open reading frames with or without GFP and mCherry controls. Do you have suggestions for... transcription factor collection, available at Addgene. The collection can be used for screening transcription... entire pooled collection, can be purchased at Addgene. Each transcription factor isoform has a unique...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...