We narrowed to 526 results for: HA tag

...fusion in which AviTag is added to either the N or C terminus of the protein. BirA has been shown to effectively...Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic...with the macromolecules it is added to. Biotin also has an exposed side chain that can be easily manipulated...coated with avidin. The biotin-avidin interaction has also been adapted for use in immunohistochemistry...biotinylation. This 13 amino acid sequence is termed AviTag. Using AviTag, one can label a protein of interest with...Scientific's Biotinylation Reagent Selection Tool. AviTag and BirA Proteins can also be biotinylated by exploiting... effectively biotinylate AviTag expressing proteins in bacteria, yeast, insect and mammalian cells. Check...

...inclusion of non-canonical amino acids or peptide tags. 5) Strong protein-protein interactions with other...or capable of producing a visible signal, but it has a strong affinity for avidin and streptavidin, both...through several different mechanisms. Most take advantage of chemical groups intrinsically present on antibodies...

... Cloning of basic parts (promoters, UTRs, genes, tags, etc.) into MoClo-compatible vectors. Level 1: Assembly...afterwards. To engineer these production pathways, MoClo has been used to assemble multigene constructs capable...

...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse... 2008) occasionally and certainly after a set-up has been changed (for instance after replacing a broken...

...you to gauge how far the DNA has migrated; 2) it contains a high percentage of glycerol that increases ...continue towards a boil. Keep an eye on it the solution has a tendancy to boil over. Placing saran wrap over ...sit at room temperature for 20-30 mins, until it has completely solidified. Pro-Tip If you are in a hurry...with water to even out the staining after the gel has been run, just as you would if you had not added ...water and destain for 5 mins. Using any device that has UV light, visualize your DNA fragments. The fragments...adjust the agarose percentage of the gel to get better separation. A higher percentage agarose gel will ...electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light source Microwave Reagents...

...directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...

...genomic attP site. So far, their practical application has been limited by low integration efficiency but research...(Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer...site is widely used. Flp FRT GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8... F3, F5, FRT14, FRT15 minimal FRT GAAGTTCCTATTCtctagaaaGTATAGGAACTTC Table 1. Summary of Cre, Dre, and...turning on another. The FLEx switch system takes advantage of the orientation specificity of Cre and the ...

...DNA glycosylase inhibitor with a degradation tag (LVA tag) to achieve specific point mutations in E. coli...multiple gRNAs on one plasmid. Sound good? Addgene has many tools to help you multiplex - we’ll use mammalian...multiple promoter-gRNA cassettes, making them advantageous for small capacity vectors like AAV. In addition.... Yin, Linlin, et al. “Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs...

...The Rinehart Lab has developed several tools useful for the incorporation of phosphoserine into your ...Plasmid 68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP...68305 Beta lactamase S68TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68300 MBP-MEK1... GFP S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ ...Plasmid 68283 SepOTSβ Plasmid 53225 MBP-MEK1 S218TAG/S222TAG ( aka. PCRT7 tetR pLtetO MBP-MEK1 XX Amp) Strain...Pooled Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306...BL21ΔserB Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 34623 SepOTSα SepRS/EF-Sep ( aka...

...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000...shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with... the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure... in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking ... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO...

...similar to the original pCas/pTargetF but has many other advantages including shorter plasmid curing time....uracil DNA glycosylase inhibitor and degradation tag on the fusion protein to limit the activity of the...in bacteria, most CRISPR-based genome engineering has taken place in other organisms. In many bacteria,... targets cells in which homologous recombination has not occurred. This powerful negative selection system...plasmids Noting that the more common spCas9 system has generally low efficiencies or can be proteotoxic ...system can be delivered a number of ways but success has been observed with Phagemids (Selle et al., 2020,...microbiome Beyond the human gut, the Barrick lab has deposited plasmids that can be used to engineer the...

...protease. Once the recipient cells take up the Cre-tagged mitochondria, Cre is released, translocates to ...FRCaMP (itself based on mApple, which means it likely has the blue-light photoswitching issue). Although similar...CRISPR/Cas9 experiments By Ashley Waldron CRISPR/Cas9 has revolutionized biotechnology — partly because of ...use quite different designs, leading to unique advantages. While most red GECIs have been derived from ...

...against your target protein, consider fusing a protein tag to the target and using an epitope-based strategy...different species/isotypes and that each secondary has a different color fluorophore that you can image ...abundant in your samples (with a primary antibody that has the same species and isotype as the primary antibody...

...Alberta studying with the Szymanski lab (though she’s tagged along with the lab during its recent move to the...cost-effective method that our lab (the Szymanski lab, which has recently moved from the University of Alberta in ...Edmonton, Canada, to the University of Georgia, USA) has developed that allows for a phage genome to be probed...library construction for functional genomic and metagenomic screening." Applied and environmental microbiology...

...the concentration of inducer or adding an affinity tag such as GST may help with solubility issues. We ... BL21 (DE3) pLysE* Chloramphenicol (pLysE) pLysE has higher T7 lysozyme expression than pLysS; expression...

...(2017). AAV-mediated Anterograde Transsynaptic Tagging: Mapping Input-Defined Functional Neural Pathways...auditory neuronal circuitry in vivo. A variant of RABV has been developed to only label a neuronal connection...example only dopaminergic neurons, neuronal tracing has the added benefit of only labelling the subset of... regions used. Evidence for retrograde transport has been found for AAV1, -2, -5, -7, -8 (Taymans et al...AAV5 (Aschauer et al., 2013). Anterograde transport has been observed for AAV1, -5, -8 (McFarland et al.,...variability compared to chemical tracers. rAAV2-retro also has lower affinity for heparin, which possibly explains...vectors cover some of these attributes and their use has allowed for the visualization of single connection...

...starting this procedure, be sure that the cell pool has been sufficiently selected with the appropriate antibiotic... antibiotic so that every cell in the culture has, in theory, been transduced. There are various schools...regularly for transgene expression. This protocol has been optimized for adherent cells but can be modified...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS 1X PBS...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable cell pool: see...

...perfect empty backbone, made sure to add the right tags to your gene, and may have even put a fluorescent...OpenWetWare's E.coli genotype resource. Additionally, NEB has a great list of genetic markers for your reference...

...beta - HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-... MHC-G HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-...MSTP084 HRAS v-Ha-ras Harvey rat sarcoma viral oncogene homolog C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-... adds a myristoylation sequence and flag-epitope tag to each ORF from the labs of William Hahn and Jean...early stage tumors ARP, MANF, MGC142148, MGC142150 ARMETL1 arginine-rich, mutated in early stage tumors-like...PAFR PTGDR prostaglandin D2 receptor (DP) AS1, ASRT1, DP, DP1, MGC49004 PTGDS prostaglandin D2 synthase..., PGDS2 PTGER1 prostaglandin E receptor 1 (subtype EP1), 42kDa EP1 PTGER2 prostaglandin E receptor 2 (...

...specific genomic edits, like point mutations or small tag insertions, by copying from a DNA donor template ...contain your desired edit. Each of these methods has their own considerations. Which one to use will come...lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector delivery. Both lentiviral and... if you provided a homology template, a large percentage of DNA breaks will be repaired by NHEJ instead...