We narrowed to 531 results for: HA tag

...%}{% end_module_attribute %}{% module_attribute "tag" is_json="true" %}{% raw %}"module"{% endraw %}{%...goodie — a phrase used to refer to something that has fallen out of fashion but is still useful and most..._block %}   Interfering in the future While RNAi has retreated a bit to the background, it remains a solid..., Fort, A., Gebhard, C., Goldowitz, D., Guhl, S., Ha, T. J., . . . De Hoon, M. J. L. (2017). An integrated...end_module_attribute %}{% module_attribute "wrap_field_tag" is_json="true" %}{% raw %}"div"{% endraw %...

...membrane-localized iLID along with your chosen SspB-tag-GEF and your cells will be ready for the spotlight...localized, rapid and reversible microtubule severing and has very low dark-state activity and toxicity. All of...could be extended to other GTPases. The Chow Lab has also generated a variety of membrane-recruitment ...engineering other enzymes. Conclusion We hope this post has illuminated some of the many tools available for ...disrupt microtubules in cells, they have various disadvantages and limitations – for example, microtubule-destabilizing...on BcLOV4. These single-component systems take advantage of BcLOV4’s light-induced binding of the plasma...dissect the roles of three Rab proteins during a key stage of zebrafish development (Aljiboury et al., 2023...

...fusion in which AviTag is added to either the N or C terminus of the protein. BirA has been shown to effectively...Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic...with the macromolecules it is added to. Biotin also has an exposed side chain that can be easily manipulated...coated with avidin. The biotin-avidin interaction has also been adapted for use in immunohistochemistry...biotinylation. This 13 amino acid sequence is termed AviTag. Using AviTag, one can label a protein of interest with...Scientific's Biotinylation Reagent Selection Tool. AviTag and BirA Proteins can also be biotinylated by exploiting... effectively biotinylate AviTag expressing proteins in bacteria, yeast, insect and mammalian cells. Check...

...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse... 2008) occasionally and certainly after a set-up has been changed (for instance after replacing a broken...

...inclusion of non-canonical amino acids or peptide tags. 5) Strong protein-protein interactions with other...or capable of producing a visible signal, but it has a strong affinity for avidin and streptavidin, both...through several different mechanisms. Most take advantage of chemical groups intrinsically present on antibodies...

... Cloning of basic parts (promoters, UTRs, genes, tags, etc.) into MoClo-compatible vectors. Level 1: Assembly...afterwards. To engineer these production pathways, MoClo has been used to assemble multigene constructs capable...

...you to gauge how far the DNA has migrated; 2) it contains a high percentage of glycerol that increases ...continue towards a boil. Keep an eye on it the solution has a tendancy to boil over. Placing saran wrap over ...sit at room temperature for 20-30 mins, until it has completely solidified. Pro-Tip If you are in a hurry...with water to even out the staining after the gel has been run, just as you would if you had not added ...water and destain for 5 mins. Using any device that has UV light, visualize your DNA fragments. The fragments...adjust the agarose percentage of the gel to get better separation. A higher percentage agarose gel will ...electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light source Microwave Reagents...

...and pharmaceutical companies. The RESOLUTE project has received funding from the Innovative Medicines Initiative... protein thermal stabilization, and changes of voltage all contribute to assess ligand action/engagement...

...genomic attP site. So far, their practical application has been limited by low integration efficiency but research...(Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer...site is widely used. Flp FRT GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8... F3, F5, FRT14, FRT15 minimal FRT GAAGTTCCTATTCtctagaaaGTATAGGAACTTC Table 1. Summary of Cre, Dre, and...turning on another. The FLEx switch system takes advantage of the orientation specificity of Cre and the ...

...The Rinehart Lab has developed several tools useful for the incorporation of phosphoserine into your ...Plasmid 68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP...68305 Beta lactamase S68TAG Plasmid 68302 MBP-MEK1 S222TAG Plasmid 68301 MBP-MEK1 S218TAG Plasmid 68300 MBP-MEK1... GFP S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ ...Plasmid 68283 SepOTSβ Plasmid 53225 MBP-MEK1 S218TAG/S222TAG ( aka. PCRT7 tetR pLtetO MBP-MEK1 XX Amp) Strain...Pooled Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306...BL21ΔserB Plasmid 34624 SepOTSα tRNA-Sep ( aka. pCAT112TAG-SepT) Plasmid 34623 SepOTSα SepRS/EF-Sep ( aka...

...DNA glycosylase inhibitor with a degradation tag (LVA tag) to achieve specific point mutations in E. coli...multiple gRNAs on one plasmid. Sound good? Addgene has many tools to help you multiplex - we’ll use mammalian...multiple promoter-gRNA cassettes, making them advantageous for small capacity vectors like AAV. In addition.... Yin, Linlin, et al. “Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs...

...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000...shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with... the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure... in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking ... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO...

...similar to the original pCas/pTargetF but has many other advantages including shorter plasmid curing time....uracil DNA glycosylase inhibitor and degradation tag on the fusion protein to limit the activity of the...in bacteria, most CRISPR-based genome engineering has taken place in other organisms. In many bacteria,... targets cells in which homologous recombination has not occurred. This powerful negative selection system...plasmids Noting that the more common spCas9 system has generally low efficiencies or can be proteotoxic ...system can be delivered a number of ways but success has been observed with Phagemids (Selle et al., 2020,...microbiome Beyond the human gut, the Barrick lab has deposited plasmids that can be used to engineer the...

...protease. Once the recipient cells take up the Cre-tagged mitochondria, Cre is released, translocates to ...FRCaMP (itself based on mApple, which means it likely has the blue-light photoswitching issue). Although similar...CRISPR/Cas9 experiments By Ashley Waldron CRISPR/Cas9 has revolutionized biotechnology — partly because of ...use quite different designs, leading to unique advantages. While most red GECIs have been derived from ...

...against your target protein, consider fusing a protein tag to the target and using an epitope-based strategy...different species/isotypes and that each secondary has a different color fluorophore that you can image ...abundant in your samples (with a primary antibody that has the same species and isotype as the primary antibody...

...Alberta studying with the Szymanski lab (though she’s tagged along with the lab during its recent move to the...cost-effective method that our lab (the Szymanski lab, which has recently moved from the University of Alberta in ...Edmonton, Canada, to the University of Georgia, USA) has developed that allows for a phage genome to be probed...library construction for functional genomic and metagenomic screening." Applied and environmental microbiology...

...genome can occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending... well-characterized and extensively studied, and has a broad tissue tropism. Table 1 gives a summary of...across a broad range of cell types in vivo. AAV-DJ has been optimized further for specific cell and tissue... tropism towards specific cell types of interest has been to create and test capsid libraries with random...systemic capsids. A systemic capsid is a capsid that has been engineered to have enhanced function after intravenous...naturally cross the BBB. The Viviana Gradinaru lab has developed a number of systemic rAAV vectors that ...preps . AAV retrograde (AAVrg) Directed evolution has also been employed to engineer an rAAV serotype variant...

...immune response has become a disadvantage for the use of rAdV vectors in gene therapy but has, however, proven...response quickly, which has limited their use in therapeutic applications. However, this has also made them the...the human population has been exposed to at least one human AdV serotype and has developed a serotype-... digest patterns to determine that the transgene has been inserted into the adenoviral backbone plasmid...other immune-modulatory molecules. Another strategy has been to use oncolytic rAdV vectors, which are replication-competent... of spontaneous reversion to RCAs, although this has been reduced by providing the E1 gene in trans within... adenovirus (RCA) Mutated adenoviral vector that has the ability to replicate and reproduce within host...

...the concentration of inducer or adding an affinity tag such as GST may help with solubility issues. We ... BL21 (DE3) pLysE* Chloramphenicol (pLysE) pLysE has higher T7 lysozyme expression than pLysS; expression...

...(2017). AAV-mediated Anterograde Transsynaptic Tagging: Mapping Input-Defined Functional Neural Pathways...auditory neuronal circuitry in vivo. A variant of RABV has been developed to only label a neuronal connection...example only dopaminergic neurons, neuronal tracing has the added benefit of only labelling the subset of... regions used. Evidence for retrograde transport has been found for AAV1, -2, -5, -7, -8 (Taymans et al...AAV5 (Aschauer et al., 2013). Anterograde transport has been observed for AAV1, -5, -8 (McFarland et al.,...variability compared to chemical tracers. rAAV2-retro also has lower affinity for heparin, which possibly explains...vectors cover some of these attributes and their use has allowed for the visualization of single connection...