We narrowed to 527 results for: HA tag
-
TypeBlog Post...%}{% end_module_attribute %}{% module_attribute "tag" is_json="true" %}{% raw %}"module"{% endraw %}{%...pAAV-CMV-OCaMP-WPRE pAAV CMV The Lohman lab has a limited quantity of AAVs that can be requested ...end_module_attribute %}{% module_attribute "wrap_field_tag" is_json="true" %}{% raw %}"div"{% endraw %...
-
Optogenetics + CRISPR, Using Light to Control Genome Editing
TypeBlog Post... dCas9 fusion protein with three red fluorescent tags in U2OS cells. Upon light activation, dCas9 is released... add the PCK upon reaching the amber stop codon, TAG. (To learn more about site-specific incorporation...light is of particular interest since blue light has limited applications in vivo. UV and blue light is...domain from A. sativa (Bubeck et al., 2018). LOV2 has a C-terminal helix that unfolds when stimulated by...gene expression. Both of these techniques take advantage of light-induced dimerization to activate their... -
Mycoplasma Contamination: Where Does It Come From and How to Prevent It
TypeBlog Post...PCR based detection, DNA staining, fluorescent tagging, agar plating, etc. Be wise to choose any of the...facilities, tissue culture labs and every cell culturist has to deal with this problem. It is estimated that mycoplasma...this induces a noticeable color change. This method has high sensitivity but low specificity (Degeling, 2012...affect the cell growth and viability. If mycoplasma has made permanent damage to the cell culture it is irreparable...Institute of Biosciences and Technology in India. Jadhav has a Master's degree in Molecular Biology (University... -
CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9
TypeBlog Post...information on multiplexing gRNAs here). Cas9 is commonly tagged with a nuclear localization sequence to enhance...last updated Dec 22, 2020 by Benoit Giquel. CRISPR has taken the genome engineering world by storm owing...that regulate a desired phenotype. In fact, CRISPR has already been used to engineer the genome of many ...to protoplast cells (plant cells whose cell wall has been removed). Another common delivery method is ...developed for plants and prime editing for plants has been developed for rice by Yiping Qi’s lab and for...2013) Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas...Rice Blast Resistance by CRISPR/Cas9-Targeted Mutagenesis of the ERF Transcription Factor Gene OsERF922... -
New Optogenetic Tools for Cytoskeleton and Membrane Control
TypeBlog Post...membrane-localized iLID along with your chosen SspB-tag-GEF and your cells will be ready for the spotlight...localized, rapid and reversible microtubule severing and has very low dark-state activity and toxicity. All of...could be extended to other GTPases. The Chow Lab has also generated a variety of membrane-recruitment ...engineering other enzymes. Conclusion We hope this post has illuminated some of the many tools available for ...disrupt microtubules in cells, they have various disadvantages and limitations – for example, microtubule-destabilizing...on BcLOV4. These single-component systems take advantage of BcLOV4’s light-induced binding of the plasma...dissect the roles of three Rab proteins during a key stage of zebrafish development (Aljiboury et al., 2023... -
Plasmids 101: Expressing shRNAs for RNA Interference
TypeBlog Post...%}{% end_module_attribute %}{% module_attribute "tag" is_json="true" %}{% raw %}"module"{% endraw %}{%...goodie — a phrase used to refer to something that has fallen out of fashion but is still useful and most..._block %} Interfering in the future While RNAi has retreated a bit to the background, it remains a solid..., Fort, A., Gebhard, C., Goldowitz, D., Guhl, S., Ha, T. J., . . . De Hoon, M. J. L. (2017). An integrated...end_module_attribute %}{% module_attribute "wrap_field_tag" is_json="true" %}{% raw %}"div"{% endraw %... -
Plasmids 101: Biotinylation
TypeBlog Post...fusion in which AviTag is added to either the N or C terminus of the protein. BirA has been shown to effectively...Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic...with the macromolecules it is added to. Biotin also has an exposed side chain that can be easily manipulated...coated with avidin. The biotin-avidin interaction has also been adapted for use in immunohistochemistry...biotinylation. This 13 amino acid sequence is termed AviTag. Using AviTag, one can label a protein of interest with...Scientific's Biotinylation Reagent Selection Tool. AviTag and BirA Proteins can also be biotinylated by exploiting... effectively biotinylate AviTag expressing proteins in bacteria, yeast, insect and mammalian cells. Check... -
Plasmids 101: Modular Cloning
TypeBlog Post... Cloning of basic parts (promoters, UTRs, genes, tags, etc.) into MoClo-compatible vectors. Level 1: Assembly...afterwards. To engineer these production pathways, MoClo has been used to assemble multigene constructs capable... -
Choosing the B(right)est Fluorescent Protein: Photostability
TypeBlog Post...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse... 2008) occasionally and certainly after a set-up has been changed (for instance after replacing a broken... -
Antibodies 101: Conjugation
TypeBlog Post...inclusion of non-canonical amino acids or peptide tags. 5) Strong protein-protein interactions with other...or capable of producing a visible signal, but it has a strong affinity for avidin and streptavidin, both...through several different mechanisms. Most take advantage of chemical groups intrinsically present on antibodies... -
Protocol - How to Run an Agarose Gel
TypeProtocol...you to gauge how far the DNA has migrated; 2) it contains a high percentage of glycerol that increases ...continue towards a boil. Keep an eye on it the solution has a tendancy to boil over. Placing saran wrap over ...sit at room temperature for 20-30 mins, until it has completely solidified. Pro-Tip If you are in a hurry...with water to even out the staining after the gel has been run, just as you would if you had not added ...water and destain for 5 mins. Using any device that has UV light, visualize your DNA fragments. The fragments...adjust the agarose percentage of the gel to get better separation. A higher percentage agarose gel will ...electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light source Microwave Reagents... -
Antibody Guide
TypeGuide...directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post...DNA glycosylase inhibitor with a degradation tag (LVA tag) to achieve specific point mutations in E. coli...multiple gRNAs on one plasmid. Sound good? Addgene has many tools to help you multiplex - we’ll use mammalian...multiple promoter-gRNA cassettes, making them advantageous for small capacity vectors like AAV. In addition.... Yin, Linlin, et al. “Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...similar to the original pCas/pTargetF but has many other advantages including shorter plasmid curing time....uracil DNA glycosylase inhibitor and degradation tag on the fusion protein to limit the activity of the...in bacteria, most CRISPR-based genome engineering has taken place in other organisms. In many bacteria,... targets cells in which homologous recombination has not occurred. This powerful negative selection system...plasmids Noting that the more common spCas9 system has generally low efficiencies or can be proteotoxic ...system can be delivered a number of ways but success has been observed with Phagemids (Selle et al., 2020,...microbiome Beyond the human gut, the Barrick lab has deposited plasmids that can be used to engineer the... -
Protocol - pLKO.1 – TRC Cloning Vector
TypeProtocol...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000...shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with... the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure... in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking ... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO... -
Antibodies 101: Multiplex Immunofluorescence
TypeBlog Post...against your target protein, consider fusing a protein tag to the target and using an epitope-based strategy...different species/isotypes and that each secondary has a different color fluorophore that you can image ...abundant in your samples (with a primary antibody that has the same species and isotype as the primary antibody... -
Technique: Probe Phage Genomes for Host Binding Proteins
TypeBlog Post...Alberta studying with the Szymanski lab (though she’s tagged along with the lab during its recent move to the...cost-effective method that our lab (the Szymanski lab, which has recently moved from the University of Alberta in ...Edmonton, Canada, to the University of Georgia, USA) has developed that allows for a phage genome to be probed...library construction for functional genomic and metagenomic screening." Applied and environmental microbiology... -
Plasmids 101: E. coli Strains for Protein Expression
TypeBlog Post...the concentration of inducer or adding an affinity tag such as GST may help with solubility issues. We ... BL21 (DE3) pLysE* Chloramphenicol (pLysE) pLysE has higher T7 lysozyme expression than pLysS; expression... -
Using AAV for Neuronal Tracing
TypeBlog Post...(2017). AAV-mediated Anterograde Transsynaptic Tagging: Mapping Input-Defined Functional Neural Pathways...auditory neuronal circuitry in vivo. A variant of RABV has been developed to only label a neuronal connection...example only dopaminergic neurons, neuronal tracing has the added benefit of only labelling the subset of... regions used. Evidence for retrograde transport has been found for AAV1, -2, -5, -7, -8 (Taymans et al...AAV5 (Aschauer et al., 2013). Anterograde transport has been observed for AAV1, -5, -8 (McFarland et al.,...variability compared to chemical tracers. rAAV2-retro also has lower affinity for heparin, which possibly explains...vectors cover some of these attributes and their use has allowed for the visualization of single connection... -
Isolating a Monoclonal Cell Population by Limiting Dilution
TypeProtocol...starting this procedure, be sure that the cell pool has been sufficiently selected with the appropriate antibiotic... antibiotic so that every cell in the culture has, in theory, been transduced. There are various schools...regularly for transgene expression. This protocol has been optimized for adherent cells but can be modified...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS 1X PBS...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable cell pool: see...