Skip to main content
Addgene

We narrowed to 311 results for: cas9 genes

Showing: 221 - 240 of 311 results
  1. Guide to Using Pooled Libraries

    Type
    Guide
    ...target gene. Positive selection screens are generally very robust, and tens of thousands of genes that ...contains a unique gene targeting sequence, but there are multiple sequences targeting each gene in the overall... multiple genes at once. A well-designed screen can help you begin to understand what genes are important...powerful tool for forward genetic screening, or identifying previously unknown genes that contribute to a ...list of genes involved in the selection NEGATIVE screen: Apply library Perform Next Generation Sequencing...identify genes that are essential for growth/survival under certain conditions. Next-Generation Sequencing... backbone, but they express or target different genes. Some libraries cover the majority of the genome...
  2. Validated gRNA Sequences

    Type
    Collection
    ...Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor... your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this gRNA sequence designed...single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with targets that are upstream...described on Addgene's CRISPR Plasmids and Resources page have been used to indicate the Cas9 application...cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut S. pyogenes 26044730...59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...
  3. Adenovirus Guide

    Type
    Guide
    ...second and third-generation vectors. This capacity is large enough to carry the Cas9 gene and a gRNA expression...packaging capacity. Large protein-coding genes and complex gene expression cassettes are often too big to...(2017). Adenovirus-mediated gene delivery: potential applications for gene and cell-based therapies in..., subsequent generations of rAdV vectors have been developed where more adenoviral genes have been removed...containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene of interest is cloned...containing the transgene of interest, and the adenoviral plasmid containing the adenoviral genes necessary ...CRISPR-Cas9 Delivery As compared to other viral vectors, rAdV vectors can provide a large transgene packaging...
  4. Fluorescent Proteins 101: When GFP lets you down

    Type
    Blog Post
    ...nuclease-deficient Cas9 can bind loci in the genome that are defined by a gRNA. Since Cas9 is a protein, a...expected to grow with the ever-expanding genetic toolbox generated by the continuous effort of numerous scientists...). GFP is the most popular, most widely used genetically encoded fluorescent probe. Several factors contribute...probe, it is the first choice when selecting a genetically encoded fluorescent tag. There are, however, ...1998). Another mutation (A206K) is necessary to generate the strictly monomeric EGFP variant, mEGFP (Zacharias..., followed by an intramolecular reaction that generates the chromophore (Tsien, 1998). Importantly, this...Thorn, 2017). These fluorescent analogues are generally added to the bathing solution and require uptake...
  5. CRISPR 101: Any Base Transversion Editors

    Type
    Blog Post
    ...inserted the deaminase into the C-terminal domain of Cas9, which narrowed the editing window and reduced A...site. Like in most other base editor designs, the Cas9 nicks the non-edited strand to encourage the cell... The HuidaGene Therapeutics team has deposited their editors, called gTBE and gCBE, with Addgene. gTBE...editors were developed, though, researchers at HuidaGene Therapeutics guessed that fusing MPG to an ABE...this promising start, the team used rational mutagenesis to produce the adenine transversion editor AYBEv3...and ABEs, they could be useful for saturation mutagenesis, and they provide a strong proof of concept for.... gGBE consists only of engineered MPG fused to nCas9. First, MPG removes the G base from DNA to create...
  6. Finding nucleic acids with SHERLOCK and DETECTR

    Type
    Blog Post
    ...similarly to Cas9 (Zetsche et al., 2015 ). Cas12a however recognizes a different PAM site and generates 5’ and... last few years, scientists have utilized CRISPR-Cas9 protein variants, Cas13, and Cas12a, to develop ...little as an hour. Find the SHERLOCK plasmids at Addgene! Applications of the SHERLOCK detection system ...j.cell.2015.09.038 Additional resources on the Addgene Blog Learn about using toehold switches to detect...multiplex genome editing abilities Resources on Addgene.org Checkout our CRISPR guide page Browse the CRISPR...
  7. Editor's Choice, August 2016

    Type
    Blog Post
    ...Directed Mutagenesis by PCR Google Forums Round Up: First Impressions of NgAgo CRISPR Between the Genes: How...Viral Transductions Single Base Editing with CRISPR Cas9 Activators: A Practical Guide 10 Steps to a Perfect...quick way to generate many mutated plasmid constructs. The second post was contributed by Addgene Scientist...month including a first of its kind for the Addgene blog - Addgene Software Engineer Kris Shamloo wrote a ... Read All Our Editor's Choice Blog Posts The Addgene Blog has had quite the up-tick in views over the...optimize and troubleshoot the system. Site Directed Mutagenesis by PCR & Single Base Editing with CRISPR For ...and discusses a newer, CRISPR-based technique to generate C->T or G->A transitions in a target sequence ...
  8. Cre-lox system

    Type
    Collection
    ...shRNA expression. Gene Switch: These constructs contain two genes of interest, Genes A and B. When Cre...Cre-dependent Cas9: Cre-dependent Cas9 can be knocked in to a mouse at the Rosa26 locus to facilitate Cas9 mediated...iRFP670, Cre, and GFP EFS Lentiviral Jacks 68468 Cas9-2A-Cre Cas9 and Cre CAG Mammalian Zhang 68477 pTRE:iRFP670...Cre-regulated gene expression. Depending on the construct, Cre may activate or repress gene expression. ... or “LSL” cassette) upstream of a gene of interest will prevent gene expression in the absence of Cre....the stop codon is excised, and gene expression proceeds. Cre-dependent Gene Knockout: Conversely, putting...on either side of a gene (called “floxing”, for “flanked by loxP”), will permit gene expression until Cre...
  9. Our Most Popular Blog Posts from 2019

    Type
    Blog Post
    ...flexibility to CRISPR editing. Using a fusion between Cas9 and reverse transcriptase and a prime editing guide... biology over the past year: CRISPR, optogenetics, chemogenetics, plasmids, fluorescent proteins, careers...proteins at Addgene. 7. Designing Your Chalk Talk for the Academic Job Interview by Erik Snapp Addgene depositor...2020! Additional resources on the Addgene Blog Read other Addgene news Find the most recent plasmid ...posts Resources at Addgene Browse the repository Find educational resources at Addgene Search for plasmids...discovery. We’ve documented many new tools on the Addgene blog and have created and updated guides on various...blogger Joachim Goedhart shares some strategies for generating GFP fusion proteins. From considering protein...
  10. Antibodies 101: Validation

    Type
    Blog Post
    ...cell line in which the gene for your protein has been mutated using CRISPR/Cas9. You check the mutation... your antibody is validated! Genetic Strategies This approach uses a gene knock-down or knock-out approach...all sample types are amenable to genetic manipulation, nor can all genes be easily knocked down or out. ...bioinformatician) to look at RNA expression of your gene of interest across a set of human tissues.  From...to knock-down expression of your target or CRISPR/Cas9 to create mutations that essentially eliminate expression...plasmid encoding your protein of interest, known as Gene of Interest (GOI), and transfect it into your favorite...this protein, which we will call Negative Control Gene (NCG) (A). Then you lyse the cells and run a Western...
  11. Searchable and Sortable gRNAs for Your Next CRISPR Experiment

    Type
    Blog Post
    .... Current table columns are target gene, species, sequence, Addgene plasmid ID (if we have one associated...reviewed articles. If you’re targeting your favorite gene with CRISPR, using one of these validated gRNAs ...associated with the gRNA), application, cas9 species, PubMed ID, and depositor. The CRISPR applications we ...is worth trying alternate names, particularly for gene names. If you find a sequence that will work for... planning an experiment to performing one.  At Addgene, over 120 labs have deposited CRISPR reagents, ...already been shown to work in CRISPR experiments. Addgene’s dedication to resource sharing has led us to develop... is welcomed for validated gRNAs that are not generated from a plasmid. If you, for example, prefer to...
  12. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ... ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter... for enChIP, as well as an anti-Cas9 antibody. Biotin tagging of dCas9 can be achieved by fusing a biotin...Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...inactive dCas9 is used to purify genomic DNA bound by the gRNA. An epitope tag(s) can be fused to dCas9 or ...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...biotin acceptor site to dCas9 and co-expressing BirA biotin ligase, as seen in the CAPTURE system. The ...
  13. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication...crRNA. This activity provides a stark contrast to Cas9 and Cpf1, which require that each DNA target have... Publication Plant ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...
  14. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ... inactive Cas9 (dCas9) fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable... throughout the chromosome. Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...
  15. CRISPR Plasmids - Parasites

    Type
    Collection
    ...developments with CRISPR-Cas9 gene editing have propelled both reverse and forward genetics of these parasites...parasites. Moreover, CRISPR-dCas9 gene regulation has also been established for some of these parasites. Together... these tools have enabled precise genetic analyses to pinpoint genes linked to parasite virulence, transmission...at a much lower efficiency than NHEJ. ID Plasmid Gene/Insert Selectable Marker PI Publication Libraries...10 guides against 8,158 predicted protein-coding genes. Do you have suggestions for other plasmids that...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...
  16. Custom CRISPR Screens & the Green Listed Software

    Type
    Blog Post
    ...presenter then showed which genes they had generated knockout mice for (all of the genes involved as I recall... each gene is not targeted by only one gRNA, instead many different gRNAs are used for each gene. At the...screens Differentially expressed genes  As the costs for global gene expression analyses like RNAseq are...test which of the differentially expressed genes found in a gene expression dataset are causal for a phenotype...differentially expressed genes that are known drug targets, or all differentially expressed genes that code for ...describes which genes were included, and how many gRNAs were identified for each gene. This file can be... if genes that you asked for were not found in the reference library. It’s not uncommon that genes have...
  17. Neurodegeneration Research Collection

    Type
    Collection
    ...type or mutant ORFs, gene fragments, and gRNAs for genes linked to neurodegenerative disorders. Find plasmids...within the huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins...association between a gene and late-onset AD. It is more likely a combination of gene variation and lifestyle... oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent rodent species... are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, TARDBP, FUS...three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals...these additional genes may play in Alzheimer's disease. Research Tools Neurodegeneration Plasmid Collection...
  18. Bacterial Expression Systems

    Type
    Collection
    ...perspective, sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome... in control of gene expression so be sure to try a few different systems with your gene/protein of interest...Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9 nuclease gRNA. For...Anhydrotetracycline inducible expression of wild-type Cas9 from S. pyogenes for inducing double stranded breaks. For...inducible expression of catalytically inactive Cas9 ( S. pyogenes ) which can be combined with expression of...Engineering Although overexpressing or knocking down a gene can tell you much about its function and/or alter...you're studying the basic biology of a bacterial gene or redirecting metabolic pathways to produce a therapeutic...
  19. CRISPR 101: Drug discovery and CRISPR

    Type
    Blog Post
    ...several candidate inhibitors of gene X in a screen. You generate a gene X knockout in a cancerous background...inhibit, activate, or knockout many genes at a time to identify ‘hits’ - genes that affect disease progression...some of the candidate genes! Disease model generation CRISPR has made the generation of genome edits accessible.... These hits can reveal individual genes or sometimes even genetic pathways that are worth investigating...known – repeat expansion, gene knock out, etc. – CRISPR can be used to generate cell line or animal models...resources on the Addgene blog CRISPR 101: Making a Knock-In Cell Line Using CRISPR-Cas9 to Edit Disease...approaches. The first route involves identifying a gene/pathway to develop a drug for (aka a druggable target...
  20. Meet the New Addgene Board Members!

    Type
    Blog Post
    ...the Grousbeck Family Chair in Gene Therapy, Director of the Grousbeck Gene Therapy Center, Associate Director...at KSQ Therapeutics and is an Addgene depositor. KSQ uses a CRISPR-Cas9 platform to systematically test...nonprofit companies. His lab focuses on gene therapy work for genetic diseases and over the past few months...deposited AAV constructs for gene delivery. In 2018, he interviewed Addgene co-founder Melina Fan and former...PhD Khandan Baradaran’s expertise in viral safety, gene therapy vector development, vaccine development,...Dimension Therapeutics, she helped build and grow the gene therapy division of the company.  Ultragenyx’s goal...test the function of all 20,000 genes in disease models and then focus drug discovery efforts on the targets...
Showing: 221 - 240 of 311 results