... enhanced sodium accumulation in their roots and (3) development of tools for data analysis/visualization... to help decide whether work is suitable for publication in their journal. The early peer-review attempts...information that would prevent the study to be replicated or omission from the literature. I think that...Addgene.org Learn about depositing plasmids pre-publication Find molecular biology protocols Find eBooks ...

...2015 Dec 31. pii: aad5725. PubMed PMID: 26721683. 3. Nelson CE, Hakim CH, Ousterout DG, Thakore PI, Moreb... some research in human embryos. Nature. 2015 Dec 3. doi:10.1038/nature.2015.18947 5. Siva K, Covello ... by zinc finger nucleases. Mol Ther. 2015a Mar;23(3):523-32. PubMed PMID: 25492562. PubMed Central PMCID...setting. CRISPR is often used for animal germline modification, to repair or add in disease-causing mutations...that AAV-CRISPR does not cause obvious germline modification, an important finding given the controversy ...Blog Learn How CRISPR Could Be Used to Treat Cataracts and Cystic Fibrosis Read How Homology Directed...

...drug clinical trial, for example).   Fig. 3: Question flowchart for choosing an ANOVA/MANOVA statistical...positive is much higher than if you only look at 2 or 3 pairwise comparisons. Similar to family-wise error...for the nonstatistician: Part I. South Med J., 105(3): 126-130 (2012). 10.1097/SMJ.0b013e3182498ad5 Curran-Everett...tests  Statistical tests fall into two general categories: parametric and non-parametric. In this blog ... exist somewhere within your data; it does not indicate which groups the differences exist between. For...that matter. However, this is oftentimes an oversimplification. If your independent variables are affecting...

...conventional gene targeting is lowered to about 2-3 months. But certain models remain more difficult to...into a zygote and obtain a knockout mouse in about 3 months. Image courtesy of Wenning Qin. Single-...cleavage right before the stop codon!  Figure 3: How to design a C-terminal insertion with Easi-CRISPR... allele To design a knock-in allele at a given location, you’ll need to design only a single guide and... out our CRISPR Guide Find Plasmids for Cas9 Purification Find CRISPR Plasmids for Mammalian Expression...

...for 1-3 days. There’s also a CRISPR for that! CRISPR interference (CRISPRi) targets a catalytically dead...most of the other mechanisms described. Fig. 3 dTag mechanism of protein degradation. Adapted from...

... previously funded grant application to see how funds were allocated. Step 3: Get feedback from your ...proposal successful. Typical proposals consist of 3 to 5 aims, with secondary milestones to meet along...the grant application process. When my PhD advisor first asked me to write a grant application due the ...the next round of applications. Step 5: Keep writing! Each written grant application builds upon the ... project grant application" by the NIH Still want more information on the application process? What types...advisor alone applies for these competitive grant applications; however, in some cases, your advisor may choose...writing, volunteered to take the lead on various applications throughout my graduate career, and helped receive...

...PMC4364232. Find the plasmids from this publication at Addgene. 3. Ma, Hanhui, et al. “Multiplexed labeling...produce yellow, cyan, or magenta light. A gRNA with all 3 distinct hairpin sequences produces white light. Created... every genomic locus, and to do so in vivo. Catalytically dead Cas9 (dCas9) cannot induce gene editing...Cas9 ortholog, and the target sequence must be located adjacent to that PAM. To scale up fluorescent CRISPR...this rainbow of colors, Ma et al. performed sophisticated tracking of multiple chromosomal loci in live... do not induce genome editing. If used with catalytically active Cas9, the short, CRISPRainbow gRNA will... PMCID: PMC3918502. Find plasmids from this publication at Addgene. 2. Ma, Hanhui, et al. “Multicolor...

...shown below, a fragment with 5’ overhang TGGA and 3’ overhang TCCG can be ligated into a vector containing...to specify assembly order, so fragments with 5’ or 3’ sequence homology cannot be assembled using this ... work around this is to "domesticate" your fragment: PCR-based amplification can be used to create silent...and exciting applications, this system is an incredibly powerful tool for cloning complicated constructs...Type IIS sites (such as BsaI or BbsI), that are located on the outside of the cleavage site. As a result...plasmid (Option 1) or added using PCR-based amplification (Option 2). Advantages of Golden Gate cloning...restriction sites that may not be amenable to "domestication", you might want to consider using an alternative...

...genetically targetable fluorescent indicators. Nature protocols. 2006 Aug;1(3):1057-65. Resources on Addgene.org...(2) allosteric rearrangements of the sensor, and (3) subsequent change in fluorescence only occurs at ... a calcium sensor Genetically encoded calcium indicators (GECIs) are fluorescent proteins linked to calcium...in living cells and organisms. Unlike chemical indicators, these DNA constructs can be delivered to intact...the sensors discussed below fall into this GECI category.   For calcium sensors, one size doesn...:509-18. Inoue M. Genetically encoded calcium indicators to probe complex brain circuit dynamics in vivo...Kanemaru K, Iino M. Genetically encoded fluorescent indicators for organellar calcium imaging. Biophysical journal...

...like The Atlantic. We’ve been in documentaries in 3 languages (Japanese, German, and English) and even...we need to do it quickly. Hiring is hard but as a 3 year Boston Globe and BBJ Best Place to Work with ...enough space! There’s enough space here at our new location to grow. We are hiring again and getting ready...to keep up with the demand with excellence and dedication. We don’t have worry or wonder if providing...research, hosting conferences, and are expanding our catalog of materials to better serve the community. We ...projects allows us to support more new projects. Diversification is happening. The Addgene team will have some...we might do. I am grateful every day for their dedication, flexibility, innovative thinking, and openness...

...pulse of 500 nm light (turn on psRaf1) followed by 3 seconds of 400 nm light (turn off psRaf1). After this...is responsible for this MEK1/2 negative feedback. 3. Studying signaling pathways in vivo Expressing photoswitchable...members of their pathways, but where the kinases are located, their signal strength, and how long their signals...and MEK1 is active or “on.” Dronpa’s color thus indicates MEK1’s current state (Green when off, dark when...domains were inserted at sites homologous to the locations they were attached to in MEK. The photoswitchable...kinases good for? There are a number of potential applications for photoswitchable kinases.  Below are a few...signaling by using psMEK1 and an ERK kinase translocation reporter with a mRuby2 fluorescent reporter ...

...microenvironments made of?  A tumor’s genesis is divided into 3 phases: initiation, progression, and metastasis. The...microenvironment’s physiology is deeply connected to these 3 stages and contains multiple cell types: fibroblasts... these stromal cell modifications, stromal cells are also constantly communicating with a tumor, proving... was contributed by Bárbara Pinho, a science communicator at the Portuguese science museum "Fábrica Centro...Proficient in transportation, exosomes are tools of communication and provide malignancy to the microenvironment... Pinho! Bárbara Pinho is currently a science communicator at the Portuguese science museum "Fábrica Centro...

...place before DNA replication. Indeed, they observed that 41/42 embryos were non-mosaic at 3 days post fertilization...showed a 3% mosaic rate, and this rate would need to be much, much lower before clinical applications could... embryos carried indels at the mutation site, indicating that repair proceeded through NHEJ rather than...attributable to CRISPR editing. Conclusions & implications One striking feature of this paper is the failure...experiments are needed before we can consider clinical applications for germline editing. Although this paper represents...

...help ensure ensure equal distribution. Lab tip #3: Barcode everything Use barcodes and scanners to keep...With barcode tracking, you will always be able to locate materials quickly and easily. Learn more about ...Additional Resources on the Addgene Blog New Educational Resource: The Addgene Videos Page 5 Science Rap...

...an improved design of the guide RNA that caps the 3’ end with a structured RNA motif. These engineered...editing tools, the desired edits are templated by the 3′ extension of the pegRNAs. PEDAR is capable of correcting...AsCas12f1. They found that this system, without any modifications, is effective in genome editing in both bacteria...therapeutically relevant gene targets and expand the application to the possible treatment of genetic disease....

... motivated reasoning. Psychological bulletin, 108(3), 480. More resources on the Addgene blog Summer SciComm...Further, when science is communicated in a format that is accessible, that communication often neglects the ...SciCommSummer Scicomm Series: Modes of CommunicationCareers in Science Communication: Science Writing... to save a few days’ worth of capsules to self-medicate with when they get a cold. A primary school teacher...dihydrogen monoxide (H2O). Studying science communication as a PhD student Fortunately, by the time I ...Otago had established the Centre for Science communication and I was accepted as a grad student. I chose...a phenomenon called “motivated reasoning,” the catchall term for a range of neat little tricks our minds...

...Minimal Tol2 or miniTol2 is a truncated version of the original Tol2 and has ~3-fold increase in transposition...the QCascade DNA-targeting module with the crRNA, 3) a transposase complex made up by three transposase... up to 10 kB in size in bacteria.   Figure 3: INTEGRATE system for RNA guided transposon insertion... It generally stays put, which makes it easy to locate in a genome. But there is a type of mobile DNA,... hyperactive and likes to jump around from one location in the genome to another. This jumping is what...most transposable elements (TEs) results in the duplication of this target site sequence at the site of insertion...This is similar to how retroviruses, like HIV, replicate. Class I TEs do not encode a transposase enzyme...

...GpNLuc and OgNLuc are available through Addgene (Cat.# 70185 and 70186, respectively). Antares Chu, J...construct for Antares is available through Addgene (Cat. # 74279). Enhanced Nano-Lanterns  Suzuki, K., et...wavelength above 600 nm. LumiFluors Schaub, F.X., et al. (3) designed two imaging probes. One consists of NLuc...PMID: 27465542. PubMed Central PMCID: PMC4974478. 3. Schaub, F.X., et al. (2015) Fluorophore-NanoLuc BRET...et al (2). In this post, I’ll cover two great applications of the NLuc technology. The first couples NLuc...fluorescence. The paper reports a wide variety of applications of the Enhanced Nano-Lanterns including monitoring...2017) Genetically encoded bioluminescent voltage indicator for multi-purpose use in wide range of bioimaging...

...cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer...in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors...primer pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...Waugh lab) 3' end of maltose binding protein, forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry...CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase...Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end ...

...the stricter sequence requirement at the terminal 3’ PAM site (Fu et al. 2013; Pattanayak et al. 2013)...every CRISPR experiment. Off-target events due to >3 bp mismatches or that are sequence-independent are...PMID: 25566793. PubMed Central PMCID: PMC4349094. 3. Bell, Charles C., et al. "A high-throughput screening...off-target sites across the genome and pinpoint the location of mismatches based on the sequences of the genome... Figure 1: Schematic representations of the indicated unbiased genotyping options. Figure reproduced...those relating to DNA structure (e.g. epigenetic modification, bulges) that may also impact off-target edits...cell-based methods are genome-wide, unbiased identification of double-strand breaks (DSBs) evaluated by...