Skip to main content
Addgene
Showing: 1 - 11 of 11 results
  1. Sequencing Primers

    Type
    Guide
    ...cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer...in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors...primer pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG...Biosciences) 3' end of Gal4 activation domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP...Waugh lab) 3' end of maltose binding protein, forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry...CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase...Invitrogen) 3' of MCS in pTrcHis vector, same as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end ...
  2. Lentiviral Guide

    Type
    Guide
    ... U3; Unique 3'; region at the 3' end of viral genomic RNA (but found at both the 5' and 3' ends of the...plasmids are all replication incompetent and may contain an additional deletion in the 3'LTR, rendering ...usually encodes for VSV-G Safety Safe. Replication incompetent: Uses 3 separate plasmids encoding various ...HIV genes. Safer. Replication incompetent and always SIN: Uses 4 plasmids instead of 3 and eliminates the...virus production are split across multiple plasmids (3 for 2nd-generation systems, 4 for 3rd-generation systems...is outlined in the simple schematic to the right. 3-4 plasmids are transfected into A293T cells: one transfer...SIN) vectors. These vectors have a deletion in the 3'LTR of the viral genome that is transferred into the...
  3. Retrovirus Guide

    Type
    Guide
    ... U3; Unique 3'; region at the 3' end of viral genomic RNA (but found at both the 5' and 3' ends of the...SIN γ-retrovirus lack most of the U3 region of the 3’ LTR and are primarily used in gene therapy research...transcription. R; Repeat region found within both the 5' and 3' LTRs of retro/lentiviral plasmids. U5; Unique 5';...the viral genomic RNA (but found at both the 5' and 3' ends of the provirus). 5' LTR in cis Acts as an RNA...proceeds through U5 and the rest of the provirus. 3' LTR in cis Terminates transcription started by 5'...read our lentivirus guide. Are γ-retroviruses replication incompetent? Yes, as with lentiviruses, the genes...
  4. CRISPR Guide

    Type
    Guide
    ...EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus...SP); SpCas9 3' NGG SpCas9 D1135E variant 3' NGG (reduced NAG binding) SpCas9 VRER variant 3' NGCG SpCas9...jejuni (CJ) 3' NNNNRYAC Neisseria meningitidis (NM) 3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW...the table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of...continue to anneal to the target DNA in a 3′ to 5′ direction. The location of any potential mismatches matters...double-strand break (DSB) within the target DNA, located3–4 nucleotides upstream of the PAM sequence. The...Each library typically contains ∼3–6 gRNAs per gene to ensure modification of every target gene, so CRISPR...
  5. Cloning

    Type
    Guide
    ... interest into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang...Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of DNA sequence. This fragment can then be cloned...naturally leaves a single adenosine (A) overhang on the 3' end of PCR products. The complementary thymine (T...vectors that has a DNA topoisomerase I fused to the 3’ end. The topoisomerase acts as a ligase that joins... protocol ), takes advantage of the properties of 3 common molecular biology enzymes: 5' exonuclease, ...digests the 5' end of dsDNA fragments to generate 3' single-stranded overhangs. DNA polymerases synthesize... Ligation Independent Cloning (LIC) relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An ...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...between two AAV transfer plasmids, the first with a 3’ splice donor and the second with a 5’ splice acceptor...transfer. Kwon I, Schaffer DV. Pharm Res. 2008 Mar;25(3):489-99. PubMed . Adeno-associated virus serotypes... Z, Asokan A, Samulski RJ. Mol. Ther. 2006 Sep;14(3):316-27. Epub 2006 Jul 7. PubMed . Recombinant AAV...therapy. Grimm D, Kay MA. Curr Gene Ther. 2003 Aug;3(4):281-304. PubMed . Vector genome integration: Adeno-associated...therapeutic applications. Clinical trials using AAV for various gene delivery applications are currently...adenovirus. These genes (E4, E2a and VA) mediate AAV replication. The transfer plasmid, Rep/Cap, and the helper...integrations may occur at a much lower frequency. As a replication-incompetent virus, AAV cannot enter the lytic...
  7. Optogenetics Guide

    Type
    Guide
    ...Halorhodopsin plasmids . Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense is also commonly ...with single-spike temporal resolution. PLoS One. 2(3):e299. PMID 17375185 Kim B, Lin MZ. 2013. Optobiology...excitation of distinct neural populations. Nat Methods. 11(3):338-46. PMID 24509633 Lin, J. 2011. A User’s Guide...control of neural activity. Cold Spring Harb Protoc. 3:top102. PMID 21363959 Yizhar O, Fenno LE, Prigge M...derived from Volvox carteri. Nat Neurosci. 11(6):631-3. PMID 18432196...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...
  8. Chemogenetics Guide

    Type
    Guide
    ...Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & ...activity. PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor sodium- or potassium-selective ...K + ions, and activates neuronal activity. Figure 3: PSAM4-based ligand-gated ion channels, their effect...routes. Image courtesy of Ute Hochgeschwender . Table 3. Descriptions of LMOs and their activity in neurons...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...chemogenetics for research and potential clinical applications. Science. 364(6436):eaav5282. PMID: 30872534... KM, Brown KM, Forbes SL, Liggett SB (2001). Modification of the beta 2-adrenergic receptor to engineer...
  9. Promoters

    Type
    Guide
    ...initiate. The TATA box is a DNA sequence (5'-TATAAA-3') within the core promoter region where general transcription...promote the initiation of transcription. The most 3' portion (closest to the gene's start codon) of the...polymerase. DNA sequences called response elements are located within promoter regions, and they provide a stable...cells. Core Promoter The core promoter region is located most proximal to the start codon and contains the...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions...eukaryotic TATA box, the Pribnow box (TATAAT) is located at the -10 position and is essential for transcription...
  10. Molecular Biology Reference

    Type
    Guide
    ...of amino acids. Each amino acid is encoded for by 3 nucleotides termed a codon. As there are only 20 natural.... Uracil replaces thymine in RNA molecules. Every 3 nucleotides (codons) in a DNA sequence encodes for...Reference Page Plasmids 101: How to Name Your Plasmid in 3 Easy Steps Molecular Cloning Techniques Reference ... Origin of Replication ( ori ) DNA sequence which directs initiation of plasmid replication (by bacteria... Educational Resources Molecular Biology Reference Molecular...plasmid selection DNA sequencing for plasmid verification Resources Genetic Code Webpage and Blog References...Techniques in chemistry enable isolation and purification of cellular components, such as DNA, but practically...
  11. Antibody Guide

    Type
    Guide
    ... a protein’s presence or absence. Figure 3: A western blot detecting proteins using the indirect detection...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...
Showing: 1 - 11 of 11 results