Skip to main content

We narrowed to 13 results for: cat.3

Showing: 1 - 13 of 13 results
  1. Sequencing Primers

    Type
    Guide
    ...pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector/td> Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of... For pBluescript vector Reverse pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' end of MCS in pGEX vectors Reverse ...Primers Name Sequence (5' to 3') Description Direction 3'AOX1 GCAAATGGCATTCTGACATCC For Pichia vectors with.... cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end of Gateway cassette Forward GW-5' ... pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...AATACCACTACAATGGAT 3' end of Gal4 activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward...GATGAAGCCCTGAAAGACGCGCAG 3' end of maltose binding protein Forward mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry...
  2. CRISPR Guide

    Type
    Guide
    ...EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus...SP); SpCas9 3' NGG SpCas9 D1135E variant 3' NGG (reduced NAG binding) SpCas9 VRER variant 3' NGCG SpCas9...jejuni (CJ) 3' NNNNRYAC Neisseria meningitidis (NM) 3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW...the table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of...continue to anneal to the target DNA in a 3′ to 5′ direction. The location of any potential mismatches matters...double-strand break (DSB) within the target DNA, located3–4 nucleotides upstream of the PAM sequence. The...Each library typically contains ∼3–6 gRNAs per gene to ensure modification of every target gene, so CRISPR...
  3. Lentiviral Vector Guide

    Type
    Guide
    ...activation. Second-generation plasmids include (Figure 3): Transfer plasmid — contains transgene and wild-type... expression from the LTR is Tat-dependent. Figure 3: Second-generation lentiviral plasmids. Created with... transfer plasmids also contain a deletion in the 3’ LTR to make them self-inactivating (SIN). This deletion...requirement for Tat. Always includes deletion in the 3' LTR for self-inactivation LTR Viral Promoter Wildtype...) plasmids. These plasmids have a deletion in the 3' LTR of the viral genome that is transferred into .... The inside out of lentiviral vectors. Viruses , 3 (2), 132–159. https://doi.org/10.3390/v3020132 PMID...Molecular Therapy — Methods & Clinical Development , 3 , 16017. https://doi.org/10.1038/mtm.2016.17 PMID:...
  4. Molecular Cloning Techniques

    Type
    Guide
    ... interest into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang...Gateway attB1 and attB2 sites attached to the 5’ and 3’ ends of the DNA sequence. This fragment can then ...which naturally leaves a single A overhang on the 3' end of PCR products. The complementary T comes from...covalently bound to the phosphate group on the free 3' T. The topoisomerase acts as a ligase that joins ... Read more in our TOPO Cloning blog post . Figure 3: Summary of TOPO cloning. TOPO = topoisomerase I. ... Ligation Independent Cloning (LIC) relies on the 3' to 5' exonuclease activity of T4 DNA polymerase. ... Educational Resources Molecular Biology Reference Molecular...
  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Gammaretroviral vectors: Biology, technology and application. Viruses , 3 (6), 677–713. https://doi.org/10.3390/...enables additional flexibility in pseudotyping. Figure 3: Gamma-retroviral vector packaging methods. Created...self-inactivating (SIN). These plasmids have a deletion in the 3' LTR of the viral genome that is transferred into ...found on each side of the provirus. The U3 (unique 3’) contains sequences necessary for activation of viral...transcription. R is the repeat region. U3 in cis Unique 3’; contains sequences necessary for activation of viral... RNA transcription. Removal of this region in the 3’ LTR creates self-inactivating viral vectors. R in... with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started by 5'...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...splice donor sequence at its 3' end, while the second vector carries the 3' portion of the gene with a ...Rep proteins essential for viral DNA replication and packaging. 3' ITR (RITR) in cis Right Inverted Terminal...and promotes RNA transcript longevity. Located between WPRE and 3'ITR. Not required but often included....protocols, see Addgene’s Viral Vector Protocols . Figure 3: Overview of rAAV vector production. Created with ...frequency which has been estimated to range from 0.01% to 3% depending on cell type and rAAV vector concentration...vectors for human gene therapy . Current Gene Therapy, 3 (4), 281–304. https://doi.org/10.2174/1566523034578285...enhanced gene transfer . Pharmaceutical Research, 25 (3), 489–499. https://doi.org/10.1007/s11095-007-9431...
  7. Chemogenetics Guide

    Type
    Guide
    ...Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & ...5HT3 PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor sodium- or potassium-selective ...K + ions, and activates neuronal activity. Figure 3: PSAM4-based ligand-gated ion channels, their effect...routes. Image courtesy of Ute Hochgeschwender . Table 3: Descriptions of LMOs and their activity in neurons...for opsin activation. Proc Natl Acad Sci USA, 113 (3), E358–E367. https://doi.org/10.1073/pnas.1510899113... Huntington's disease pathogenesis. iScience, 28 (3), 112022. https://doi.org/10.1016/j.isci.2025.112022...1157–1167. https://doi.org/10.1038/s41593-020-0661-3 PMID: 32632286 Nakajima, K., & Wess, J. (2012). Design...
  8. Promoters

    Type
    Guide
    ...example of a negatively-controlled operon (Figure 3). A positive-repressible operon works in the opposite...example of a positively-controlled operon. Figure 3: Lac operon regulation. Created with BioRender.com...proteins) make up the transcription complex. The most 3' portion (closest to the gene's start codon) of the...Constitutive Yeast Very strong promoter from glyceraldehyde 3-phosphage dehydrogenase; also called TDH3 or GAPDH... Educational Resources Molecular Biology Reference Promoters...BioRender.com. DNA sequences called response elements are located within promoter regions, and they provide a stable...Promoters in bacteria contain two short DNA sequences located at the -10 (10 bp 5' or upstream) and -35 positions...
  9. Optogenetics Guide

    Type
    Guide
    ...spectra Example: Jaws Archaerhodopsins Archaerhodopsin-3 (Arch) from Halorubrum sodomense is also commonly ...with single-spike temporal resolution. PloS One, 2 (3), e299. https://doi.org/10.1371/journal.pone.0000299... of distinct neural populations. Nat Methods, 11 (3), 338–346. https://doi.org/10.1038/nmeth.2836 PMID...of neural activity. Cold Spring Harb Protoc, 2011 (3), top102. https://doi.org/10.1101/pdb.top102 PMID:...Channelrhodopsins: cation channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from...light of the correct wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron...more information on biosensors such as calcium indicators or voltage sensors, visit our Biosensors Plasmid...
  10. Molecular Biology Reference

    Type
    Guide
    ...chain-termination sequencing or dideoxy sequencing (Figure 3). Sanger sequencing relies on the random incorporation... efficient and reliable sequencing method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com.... Uracil replaces thymine in RNA molecules. Every 3 nucleotides (codons) in a DNA sequence encodes for...Origin of Replication ( ori ) DNA sequence which directs the initiation of plasmid replication in bacteria... not located elsewhere in the plasmid backbone. In expression plasmids, the MCS is often located downstream...advantage of the process of DNA replication in vitro. During replication, the DNA helix is unwound by a... Educational Resources Molecular Biology Reference Molecular...
  11. Plan Your Experiment

    Type
    Guide
    ...a template. In general, edits must be downstream (3’) of the nick site, and guides that target closer ...control of gene repression and activation. Cell , 159 (3), 647–661. https://doi.org/10.1016/j.cell.2014.09.029...Achieving your desired edit comes down to location, location, location. Positioning your chosen Cas enzyme ...designing the gRNA component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations...the table below, we highlight the most common categories of genetic manipulations used in mammalian cells...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...start sites that could allow for expression of a truncated protein. Targeting an exon coding for an essential...
  12. Adenovirus Guide

    Type
    Guide
    ...structures that promote primase-independent DNA replication. 3' ITR (RITR) in cis Right Inverted Terminal ... first- and third-generation rAdV vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com... DNA replication and host cell manipulation. Late transcripts are expressed after DNA replication starts...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate autonomously..., which has limited their use in therapeutic applications. However, this has also made them the most widely...presence of adenoviral genes E1, E4, E2a and VA for replication. For more information about AAVs, read our AAV...whereas the E1 region is essential for viral replication and therefore needs to be supplied through other...
  13. Antibody Guide

    Type
    Guide
    ... a protein’s presence or absence. Figure 3: A western blot detecting proteins using the indirect detection...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...
Showing: 1 - 13 of 13 results