Skip to main content
Addgene
Showing: 1 - 20 of 35 results
  1. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo: 3' - GTATAC AATTAATT CCGCGCGG...: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3' - G GTATAC AATTAATT CCGCGCGG...To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...CCGCGCGG GTTAAC CAGCT - 5' Note: We could leave off the 3’ G on each oligo (and the complementary C of the other...tube. Place tube in 90-95°C hot block and leave for 3-5 minutes. Remove the hot block from the heat source... vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate...
  2. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and ...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design... the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to ...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a ...assist with restriction enzyme digestion (usually 3-6bp). Restriction Site: Your chosen restriction site...
  3. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    .... sin 3’LTR 3’ Self-inactivating long terminal repeat. f1 ori f1 bacterial origin of replication. Amp ...antisense—TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3’ For example...bacterial origin of replication. 5’LTR 5’ long terminal repeat. RRE Rev response element. A.3 Related Products...’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’ AATTCAAAAA...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO...Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids B. Designing shRNA Oligos for pLKO... C.1 Recommended materials C.2 Annealing oligos C.3 Digesting pLKO.1 TRC-Cloning Vector C.4 Ligating and...
  4. AAV Titration by qPCR Using SYBR Green Technology

    Type
    Protocol
    ...95 uL 20X 200X Dilution 3 20 uL Dil. 2 80 uL 5X 1000X Dilution 4 20 uL Dil. 3 80 uL 5X 5000X Dilution ...x 10 12 GC/mL, use dilutions 3–6 If sample is expected to have a titer >3 x 10 13 GC/mL, use dilutions...detection: 98 °C 3 min / 98 °C 15 sec / 58 °C 30 sec / read plate/ repeat 39x from step 3 / melt curve Example...Update: February 13, 2019 Estimate of time required: ~3 h Workflow Timeline Plate set-up: 2 h qPCR run: 1.5...dilution 90 2 x 10 4 10 of 2 x 10 4 dilution 90 2 x 10 3 Pro-Tip To help stabilize the standards add carrier... Example of plate set-up: 1 2 3 4 5 6 7 8 A 1.00 x 10 9 1.00 x 10 8 1.00 x 10 7 1.00 x 10 6 1.00 x 10 ...10 5 1.00 x 10 4 empty NTC C AAV reference Sample 3 D E Sample 1 Sample 4 F E Sample 2 Sample 5 F Perform...
  5. Ligation Independent Cloning

    Type
    Protocol
    ...reaction, meaning that T4 Pol will remove bases from the 3' end of the cut site until the first G is reached ...minimum of 18 bp of your template sequence. 5' and 3' primers will have different leader sequences, but... the same principle (homologous to the first G on 3'-5' strand from cut site). For simplicity, only the...salt concentrations in subsequent reactions. Step 3: Create Vector Overhangs Treat the linearized vector...vector with T4 DNA polymerase to "chew back" the free 3' ends, following the manufacturer's instructions. ...treated vector and insert at a molar ratio of 1:2 or 1:3, using between 20 and 50 ng of vector per annealing... plasmid together through the transformation/replication process. LIC employs long overhangs to form a...
  6. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ...situations where the 3:1 ratio is not working or when doing more complicated cloning. While 3:1 will get you...enzyme on the 5' end and a different enzyme on the 3' end). This ensures that the insert will be added ...cloning (where the insert is smaller than the vector) a 3 insert : 1 vector molar ratio will work just fine....reagents Optimizing the Vector:Insert Ratio Although a 3:1 insert to vector ratio is usually sufficient, you...on the length of the DNA to get a proper ratio of 3 available insert ends for every available vector end...performed by the T4 DNA ligase enzyme. The DNA ligase catalyzes the formation of covalent phosphodiester linkages...troubleshooting failed ligations. The following table indicates the various controls: Control Ligase Interpretation...
  7. Protocol - How to Design Primers

    Type
    Protocol
    ...strand completely; it is essential, however, that the 3’ end of the primer corresponds completely to the template...proceed. Usually a guanine or cytosine is used at the 3’ end, and the 5’ end of the primer usually has stretches...stretches of several nucleotides. Also, both of the 3’ ends of the hybridized primers must point toward ...restriction site at the 5’ end of your primer, note that a 3-6 base pair "clamp" should be added upstream in order...primers produce inaccurate, nonspecific DNA amplification product, and long primers result in a slower...which creates primer dimers and disrupts the amplification process. When designing, if unsure about what...
  8. CRISPR Library Amplification

    Type
    Protocol
    ...recover, set up overnight growth (Estimated time 2-3 hours) Transformation should be performed at the end...Day 2: Harvest cells and purify DNA (Estimated time 3-4 hours) Cells should be harvested first thing in ...µL micropipette tips in a -20 °C freezer. Aliquot 3 mL SOC into each of four 14 mL Vented Falcon Tubes...cuvette and add to 14 mL vented Falcon Tube containing 3 mL SOC. Repeat for each of the 25 µl aliquots of cell...Vented Falcon Tubes should contain a total of 5 mL (3 mL SOC + 2 mL transformed Endura from two separate... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...
  9. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    ... of 25% iodixanol step 5 mL of 40% iodixanol step 3 mL of 60% iodixanol step Carefully add up to 5 mL ... tubes. Repeat for each QuickSeal tube. The first 3 mL collected corresponds to the 60% phase and can ...from the 40% phase contain the purified AAV. Option #3 Puncture the QuickSeal tube slightly below the 60–...Link opens in a new window) copyright (2006). Figure 3: Example of an SDS-PAGE gel of 10 consecutive gradient.... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...
  10. General Transfection

    Type
    Protocol
    ...transfected using 1:1, 1:2, 1:3 and 1:6 µg of pRosetta :µg of PEI. The 1:2 and 1:3 ratios provided high transfection...transfection - Remove media, replace with fresh media Day 3 or more (am): Observe fluorescence, harvest cells,...high levels of virus. HEK293T cells should be split 3 times a week: Monday: Plate 1x10 6 cells in a 75 cm...negative E. coli strain such as NEB stable. Dilute 1:3 (µg DNA:µg PEI) in 500 µL total of OptiPro SFM (per...of 1 mg/mL PEI (μL) 1:1 18.9 18.9 1:2 18.9 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9 113.4...inhibit transfection; therefore, plasmid DNA purification should include an endotoxin removal step. For...
  11. Lentivirus Production

    Type
    Protocol
    ...total DNA to μg PEI ratios of 1:1, 1:2, 1:3 and 1:6. The 1:2 and 1:3 total DNA:PEI μg ratios provided high...post-transfection. Remove media, replace with fresh media. Day 3-4 (am): Harvest virus Equipment Class II, Type A2 ...obtaining high viral titer. 293T cells should be split 3 times a week: Monday: Plate 1×10 6 cells in a T75 ...enough PEI such that the ratio of μg DNA:μg PEI is 1:3 (1000 μL total per 10 cm dish). Using transfer plasmid...DNA μL of 1 mg/mL PEI 1:1 18.9 18.9 1:2 18.9 37.8 1:3 18.9 56.7 1:4 18.9 75.6 1:5 18.9 94.5 1:6 18.9 113.4...lentivirus can be used for a variety of downstream applications such as stable-cell line generation. Workflow...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...
  12. Colony Formation Titering Assay

    Type
    Protocol
    ...with fresh media containing selection reagent Days 3–14: Change media as needed Days 14–18: Stain cells...be killed and no colonies should be visible. Every 3–4 days, gently aspirate the media and replace it with...selective reagent for 12 days with media exchanges every 3–4 days. Colonies were then stained with 0.1% crystal...selective reagent for 12 days with media exchanges every 3–4 days. After 12 days of selection, no cells have ...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.1%...Figure 1: A549 cells were transduced with the indicated serial dilutions of the lentiviral vector pRosetta...Figure 2: A549 cells were transduced with the indicated serial dilutions of the lentiviral vector pHAGE...
  13. Molecular Biology Protocol - Restriction Digest of Plasmid DNA

    Type
    Protocol
    ... 1 µg DNA 1 µL of each Restriction Enzyme 3 µL 10x Buffer 3 µL 10x BSA (if recommended) x µL dH 2 O (to... T4 DNA Polymerase or Klenow DNA Polymerase I for 3′ overhang removal and 5′ overhang fill-in. If you ...The amount of DNA that you cut depends on your application. A diagnostic digest typically involves ∼500 ...volume usually varies from 10-50 µL depending on application and is largely determined by the volume of DNA...manufacturer’s instructions. Pro-Tip Depending on the application and the amount of DNA in the reaction, incubation...you will be using the digested DNA for another application (such as a digestion with another enzyme in a...70 °C for 15 mins, or purifying the DNA via a purification kit, such as a (Link opens in a new window) ...
  14. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...Cells Day 2–3 (am): Remove media, replace with fresh media containing selection reagent Day 3–14: Change...300 200 1:10 150 350 1:50 30 470 1:100 15 485 1:500 3 497 Add 0.5 mL of a single viral dilution to each ...cell death, the cell media should be changed every 2–3 days to maintain the dose of antibiotic, which may...without calcium or magnesium, Corning 21-040-CV (cations can affect the attachment of adherent cells) 0.45...lower dilutions depending on your downstream applications. If you’ve titered your virus beforehand, you...that the transgene has integrated in different locations in the various cells in the culture. This is because...
  15. Gibson Assembly Protocol

    Type
    Protocol
    ...end that is identical to an adjacent segment and a 3′ end that anneals to the target sequence. One strategy...reaction: T5 Exonuclease - creates single-strand DNA 3’ overhangs by chewing back from the DNA 5’ end. Complementary...) to the isothermal reaction mix. ET SSB protects 3’ ssDNA ends from the ssDNA-specific endonuclease activity...product, gel-purify DNA segments. Otherwise, PCR purification or even the raw PCR mix can work fine in an ...
  16. Immunocytochemistry

    Type
    Protocol
    ... 20, 2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment Pipette controller...a 24-well cell culture treated plate. Seed 5 x 10 3 HeLa cells per well. Allow the HeLa cells to grow ... min in 500 µL PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on ...Guide Western Blot Protocol Recombinant Antibody Purification Protocol Introduction Immunocytochemistry is...as methanol or acetone may be better for some applications. Remove the paraformaldehyde and follow your...
  17. AAV Production in HEK293 Cells

    Type
    Protocol
    ...0: Seed cells in CS2 Day 2: Seed cells in CS5 Day 3 (am): Transfect cells Day 7 (am): Harvest cells Equipment...interest Triton X-100 Benzonase/DNAse I (Millipore 71205-3) 40% Polyethylene Glycol 8000 (PEG) + 0.5 M NaCl Cell... PBS and add 35 mL of 0.05% Trypsin/EDTA. Wait ~2-3 minutes for cells to detach. Gently tap the sides ...stir slowly at 4 °C for 1 h, then keep at 4 °C for 3 h without stirring to allow full precipitation. Precipitation... at 4 °C if needed. Transfer the entire sample to 3 x 500 mL conical bottles and centrifuge at 3900 rpm... of sonication to avoid overheating of the sample. Mix well between rounds of sonication. Sonicate until...container pH meter Stir plate Magnetic stir bar Sonicator Ear protection Vortex Reagents Adherent HEK293T...
  18. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest antibody Equipment Biosafety...tube and vortex with three 1 s pulses. Incubate for 3 min at room temperature. Transfer the flask of HEK293...to mix. Return the flask to the incubator. Section 3: BCD Feed and valproic acid supplementation During...General Transfection Protocol Recombinant Antibody Purification Protocol Introduction Transfections allow for...antibody can be purified for use in a variety of applications. Sharing speeds science. We believe that sharing...antibody-expressing plasmids containing the SV40 origin of replication use a HEK293 line stably expressing the SV40 ... containing the Epstein-Barr virus origin of replication use a HEK293 line stable expressing Epstein Barr...
  19. What is Polymerase Chain Reaction (PCR)

    Type
    Protocol
    ...anneal to the regions upstream (5’) and downstream (3’) of the DNA segment to be amplified. When these reagents... increase the time of the denaturing. Your 5’ and 3’ primers should be designed to have similar melting...Reverse Primers: Hybridize and are complementary to the 3’ ends of the sense and anti-sense strands of the template...adequately. Divalent cations such as Mg 2+ and Mn 2+ stabilize the buffer solution. These cations can also be ...used for PCR-mediated DNA mutagenesis. A higher cation concentration increases the error rate of the DNA... provide a suitable environment for the DNA amplification reaction. Reference Page Top Index...
  20. Protocol - How to Perform a Diagnostic Digest

    Type
    Protocol
    ...plasmid fingerprinting", where you cut the plasmid into 3-8 pieces such that all (or most) fragments are small...insert, but significantly off center (ideally around 1/3 of the way from one end), and also cuts in the backbone... . The pattern of the fragments on the gel can indicate if the plasmid contains the expected size insert...before use of more expensive forms of plasmid verification, such as DNA sequencing . In the example above...side of the insert, you can get a very obvious verification of the orientation so long as the expected products...
Showing: 1 - 20 of 35 results