...after all the optimization, turn on the laser and watch what happens. Who knows, you may observe something...Technical differences include the ferrule implants and patch cables. One huge advantage of using rats is their...

...biosensor with a binding affinity that is better-matched to the potassium concentrations in cells than existing...lactate biosensors, and its affinity is better-matched to cellular concentrations of lactate. The microfluidic...

...trusted secondary antibodies on hand to mix and match with a larger collection of primary antibodies. ...suits your experiment (i.e. the spectral properties match your available imaging instruments and the spectral...

...animal the antibody was produced in or an isotype-matched control antibody. This control addresses situations...in preimmune serum ‌as well as with an isotype-matched control.      Figure 3: A preimmune serum...

...excision repair (BER), the cellular process that catches mutated U’s in DNA and ideally converts them back...gRNA/sgRNA Guide RNA RNA used by Cas9 to locate a matching DNA sequence.   Target strand The DNA strand...

...35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen...primer LacI-R GGCATACTCTGCGACATCGT 5' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ... pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...

...produced from plasmids and have very little batch-to-batch variation. Confirmation of sequence can be ...

...even at 4 °C, so when in doubt, make up a fresh batch.  Antibodies We always recommend either using an...sure the sensitivity of your exposure solution matches the expected amount of protein in your samples....

....addgene.org/CRISPR/ to browse CRISPR plasmids, watch informational videos, download protocols, and more...ligation using SpyLigase Building off their SpyTag/SpyCatcher system for protein-peptide locking, Mark Howarth...

...direction. The location of any potential mismatches matters. Mismatches between the target sequence in the ...target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target ... seed sequence inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...contains the desired edit as well as additional DNA matching the sequence immediately upstream and downstream...resulting heteroduplex is resolved by the cell’s mismatch repair system. Alternatively, the edited 3’ flap... sgRNA directs Cas9n to a nearby site, driving mismatch repair using the edited strand as a template PE4...