Skip to main content
Addgene

We narrowed to 34 results for: ATC

Showing: 1 - 20 of 34 results
  1. Protocols for Molecular Biology, Plasmid Cloning, and Viral Preps

    Type
    Protocol
    ...BSL-1 and BSL-2 Watch the Video! Water Baths Proper water bath maintenance and use Watch the Video! Pipetting...plate Watch the Video! Streaking Bacteria Isolate single bacterial colonies on an agar plate Watch the ...enzymes Watch the Video! Polymerase Chain Reaction (PCR) Basic PCR protocol with tips and FAQ Watch the Video... a gel Watch the Video! How to Design a Primer Key considerations when designing primers Watch the Video...recombinant antibodies Watch the Video! Western Blot Separate and detect specific proteins Watch the Video! Immunocytochemistry...protect yourself when working in BSL-1 and BSL-2 labs Watch the Video! Lab Safety for Biosafety Levels One and...dispense liquids, and how to handle the pipette Watch the Video! Centrifugation Learn about selecting ...
  2. Plasmid Cloning by PCR (with Protocols)

    Type
    Protocol
    ...Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'. Many restriction enzymes do not cut...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...
  3. General Transfection

    Type
    Protocol
    ...determined for each new batch of 1 mg/mL PEI prepared. There may be variation between batches of PEI depending... volumes, pH adjustment etc. Consequently, each batch needs to be validated and the best ratio of mass... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...
  4. Lentivirus Production

    Type
    Protocol
    ...OptiPro SFM per 10 cm dish. Pro-Tip There can be batch to batch variation when making the PEI working stock... need to be empirically determined for each new batch of 1 mg/mL PEI and for each cell line. Considerations... PEI needs to be empirically determined. Once a batch of PEI is prepared, transfect cells with a fluorescent...
  5. Lentivirus ddPCR Titration

    Type
    Protocol
    ...tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc PrimePCR ddPCR Copy Number...untransduced control. Pro-Tip For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of ...
  6. Protocol - Over-Agar Antibiotic Plating

    Type
    Protocol
    ...genes, as one does not need to prepare separate batches of antibiotic-containing agar. This protocol will...concentration. Last Update: Oct. 27, 2017 Protocol Video Watch the protocol video below to learn how to spread ...
  7. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...search for 21nt sequences that match the pattern AA(N 19 ). If no suitable match is found, search for NAR(N...Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. TIP: Addgene recommends...
  8. Protocol - How to Perform Sequence Analysis

    Type
    Protocol
    ...each reaction Tips and FAQs My sequence doesn’t match Addgene’s sequencing result, what should I do? Check... Check your trace file first; the apparent mismatch/mutation may be the result of a mis-called peak in...
  9. Protocol - How to Inoculate a Bacterial Culture

    Type
    Protocol
    ...overnight culture of liquid LB with bacteria. Video Watch the protocol video below to learn how to inoculate...Double check that the antibiotic in your LB media matches the antibiotic resistance on your plasmid. If the...
  10. Protocol - Bacterial Transformation

    Type
    Protocol
    ...transformations. Last Update: Nov. 13, 2017 Protocol Video Watch the protocol video below to learn how to isolate...antibiotic. The resistance gene on your plasmid must match the antibiotic on the plate. You should also add...
  11. Colony Formation Titering Assay

    Type
    Protocol
    ... dose for the colony formation assay. Prepare a batch of DMEM complete containing 10 μg/mL polybrene by...cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute 7,000 cells into 9.45...
  12. Pipetting Protocol

    Type
    Protocol
    ... the pipette. Last Update: September 2022 Video Watch the video for tips on pipetting in the lab. Equipment...may consider using a multichannel pipette. Please watch Addgene’s protocol on multichannel pipetting to ...
  13. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...lengths). Last Update: Feb. 20, 2018 Protocol Video Watch the protocol video below to learn how to perform...Very slowly and steadily, push the sample out and watch as the sample fills the well. After all of the sample...
  14. Virus Protocol - Generating Stable Cell Lines

    Type
    Protocol
    ...lowest dose that kills all of the cells. Prepare a batch of DMEM complete + 10 µg/mL polybrene by diluting...solution in this step. To seed the cells: Prepare a batch of cells as follows: Dilute 350,000 cells into a...
  15. Pouring LB Agar Plates

    Type
    Protocol
    ... Protocol Video Before you begin this protocol, watch the protocol video below to get a quick idea of ...including the identity of the antibiotic. Pro-Tip We batch label our plates with colored marker - particular...
  16. Western Blot

    Type
    Protocol
    ...antibody Day 2: Incubate with secondary antibody Video Watch this instructional video to learn how to use western...determine the optimal dose. Secondary antibodies must match the host species of the primary antibody. For example...
  17. Kit Free RNA Extraction

    Type
    Protocol
    ...solubility of the RNA. Pro-Tip To prevent overdrying, watch the pellet and carefully remove any residual ethanol...
  18. Protocol - How to Design Primers

    Type
    Protocol
    ...GCGGCG-restriction site-your sequence). Protocol Video Watch the protocol video below to learn how to design ...
Showing: 1 - 20 of 34 results