Skip to main content

We narrowed to 7 results for: ATC

Showing: 1 - 7 of 7 results
  1. Sequencing Primers

    Type
    Guide
    ...35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen...primer LacI-R GGCATACTCTGCGACATCGT 5' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ... pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of...List Primer Sequence & Description 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...
  2. CRISPR Guide

    Type
    Guide
    ...direction. The location of any potential mismatches matters. Mismatches between the target sequence in the ...target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target ... seed sequence inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...contains the desired edit as well as additional DNA matching the sequence immediately upstream and downstream...resulting heteroduplex is resolved by the cell’s mismatch repair system. Alternatively, the edited 3’ flap... sgRNA directs Cas9n to a nearby site, driving mismatch repair using the edited strand as a template PE4...
  3. Plan Your Experiment

    Type
    Guide
    ...the selected target sequence. Additionally, any mismatches between a given gRNA sequence and your genomic...Method CRISPR Edit Type Additional Considerations Mismatch cleavage assay Knockouts Some point mutations ...
  4. Educational Resources

    Type
    Guide
    ...Fluorescent Proteins 101 Science Career Guide Videos Watch our collection of video content , including protocols...
  5. Adenovirus Guide

    Type
    Guide
    ...plasmid and the adenoviral backbone plasmid have matching left and right homology arms which facilitate ...
  6. Antibody Guide

    Type
    Guide
    ...small aliquots of many different antibodies and do batch validation up front rather than risk delaying a ...
Showing: 1 - 7 of 7 results