...35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen...primer LacI-R GGCATACTCTGCGACATCGT 5' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ... pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...

...direction. The location of any potential mismatches matters. Mismatches between the target sequence in the ...target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target ... seed sequence inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...contains the desired edit as well as additional DNA matching the sequence immediately upstream and downstream...resulting heteroduplex is resolved by the cell’s mismatch repair system. Alternatively, the edited 3’ flap... sgRNA directs Cas9n to a nearby site, driving mismatch repair using the edited strand as a template PE4...

... when mismatches occur near the PAM sequence, so gRNAs with no homology or those with mismatches close...on-target cleavage. The gRNA target sequence needs to match the target locus, but it is also critical to ensure...ensure that the gRNA target sequence does NOT match additional sites within the genome. In a perfect world...at the same position in spite of being a perfect match for the target sequence. Many gRNA design programs...your desired edit, including but not limited to: Mismatch-cleavage assay (for NHEJ repaired DSBs): Provides...

...Fluorescent Proteins 101 Science Career Guide Videos Watch our collection of video content , including protocols...

...shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate ...

...small aliquots of many different antibodies and do batch validation up front rather than risk delaying a ...