Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 8 results for: ATC

Clear keywords
Showing: 1 - 8 of 8 results

  1. Sequencing Primers

    Type
    Guide
    ...Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter...Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin...Forward LacI-R GGCATACTCTGCGACATCGT 5' end of LacI Reverse LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ ...LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter...Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC Moloney...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet ...Forward GAGGTATATATTAATGTATCG 5' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG 3' of...

  2. CRISPR Guide

    Type
    Guide
    ...direction. The location of any potential mismatches matters. Mismatches between the target sequence in the ...target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target ... seed sequence inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...contains the desired edit as well as additional DNA matching the sequence immediately upstream and downstream...resulting heteroduplex is resolved by the cell’s mismatch repair system. Alternatively, the edited 3’ flap... sgRNA directs Cas9n to a nearby site, driving mismatch repair using the edited strand as a template PE4...

  3. Plan Your Experiment

    Type
    Guide
    ...the selected target sequence. Additionally, any mismatches between a given gRNA sequence and your genomic...Method CRISPR Edit Type Additional Considerations Mismatch cleavage assay Knockouts Some point mutations ...

  4. Educational Resources

    Type
    Guide
    ...Fluorescent Proteins 101 Science Career Guide Videos Watch our collection of video content , including protocols...

  5. Chemogenetics Guide

    Type
    Guide
    ..., T., Sugg, E. E., Candelore, M. R., Keys, R., Patchett, A. A., & Dixon, R. A. (1991). Allele-specific...

  6. Adenovirus Guide

    Type
    Guide
    ...plasmid and the adenoviral backbone plasmid have matching left and right homology arms which facilitate ...

  8. Antibody Guide

    Type
    Guide
    ...small aliquots of many different antibodies and do batch validation up front rather than risk delaying a ...
Showing: 1 - 8 of 8 results