We narrowed to 347 results for: ATC
-
TypeCollection...44249 pdCas9-bacteria pTetO Anhydrotetracycline (aTc) Escherichia coli Stanley Qi 11518 pDest-527 T7-lacO...Moeglich 68940 pRMC2 Pxyl/TetO Anhydrotetracycline (aTc) Staphylococcus aureus Tim Foster 36267 pBAD33.1 ... Lu 17972 pSE100 Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Sabine...Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline (aTc) Escherichia coli , Mycobacterium tuberculosis Vinay...Christopher Marx 44448 pLC291 pR/TetO Anhydrotetracycline (aTc) Methylobacterium extorquens Christopher Marx 122635... Peters 127088 pMS17 tcp830 Anhydrotetracycline (aTc) Streptomyces sp. Maggie Smith 74065 pZ8-Prp PprpD2...
-
The Golden Stopwatch Award: Recognizing Facilitators of Research
TypeBlog Post...efforts is the Golden Stopwatch Award to celebrate exemplary TTOs. Our new Golden Stopwatch Award recognizes...agreement (usually) must be executed. The Golden Stopwatch Award highlights TTOs that accelerate science ...agreements quickly! If your TTO receives a Golden Stopwatch, consider sending an email to thank them--after...examples if possible Tell them about the Golden Stopwatch! Any organization that deposits with and/or [email protected] Congratulations to the Golden Stopwatch awardees! Congratulations to all of the winners... -
Bikard Lab - CRISPR Repression Collection
TypeCollection...pLC97 plasmid allows for quick integration of the aTc-inducible pTet-dCas9 in the attachment site of the... or 20 matching nucleotides, the second binds to mcherry with either 0, 11, 18, or 20 matching nucleotides...thus strongly decreasing the expression level. Mismatches between the guide RNA and the target sequence...repression level. By controlling the number of mismatches we can obtain a range of expression levels. This... -
The CRISPR Software Matchmaker: A New Tool for Choosing the Best CRISPR Software for Your Needs
TypeBlog Post...functions. Many tools have also opted to mix-and-match different scoring algorithms and parameters. This...that make each tool unique. The CRISPR Software Matchmaker is composed of these features and enables you...multi-target design”, “off-target aware”, “high mismatch limit”, “approximate design”, “empirical design.... Trends: The most common utility functions are batch design or multiplex features. However, tools aiding...at the glossary section of the CRISPR Software Matchmaker, it provides a list of terms I think are important...going shopping for one. Use the CRISPR Software Matchmaker to select the best tool based on your needs. ...on How to Design a gRNA Read Our CRISPR Guide to Catch up on All the CRISPR Basics Read Other Blog Posts... -
Recombinase-based State Machines Enable Order-dependent Logic in vivo
TypeBlog Post...BxbI gene downstream of the anhydrotetracycline (ATc)-inducible promoter (PLtetO), the TP901 gene downstream...efficiently do RSMs work? We tested a two-input (ATc and Ara) RSM over a time series of increasing input... -
CRISPR-based Genome Editing Systems For Editing in E. coli
TypeBlog Post... multicopy integration. (B) Anhydrotetracycline (aTc) induces expression transposases leading to increased... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post... the inducer, in this case anhydro-tetracycline (aTc). By cloning in two tandem copies of the gRNA cassette...recombineering, the locus of interest is modified to match the repair template, and the locus cannot be recognized... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...abcg2a TAL3400 & TAL3401 TGTCCTCATCCCCGTCCCgccgcggcgccaccgtCAGCTTCCACAACATCAA adam15 TAL3016 & TAL3017...Aminopeptidase-o TAL3020 & TAL3021 TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA... TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA...arap3a TAL3026 & TAL3027 TGGCAACAATCGGTCCGTgctcagatgcagaggaCCTGTTGGCTTCCATCCA ARSA TAL 3002 & TAL 3003... asun TAL3404 & TAL3405 TAACTCAAGCCAACTCCAggaaacatcaggagtttGCAGGAAGATTGAGTTCA atf6 TAL3406 & TAL3407 TCCAACCAGCAAAAAGACccatccaggtgtgccccaAGGTTTCCATTCAGCCTA... TCCAACCAGCAAAAAGACccatccaggtgtgccccaAGGTTTCCATTCAGCCTA atg5 TAL3218 & TAL3219 TAAAGTCAAGAAACATTTtctcaaagtcatgaagGCAGAGGATGTGGAGGAA... atg12 TAL3216 & TAL3217 TTAATCAGTCGTTTGCGCcatcaccggaccaagaAGTTGGTGTGCTTTTTGA avpl TAL3220 & TAL3221 TGCTGTGTGTGCTCGCGCtctccacgctctcgtcTGCCTGCTACATCCAGAA... -
Validated gRNA Sequences
TypeCollection...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S....factors include: Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA...pyogenes 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall...25543152 Hanna BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu ...pyogenes 26472758 Sabatini C3orf17 H. sapiens GTGTGAGAATCCCTAAGGCG 70652 cut S. pyogenes 26472758 Sabatini ... pyogenes 24284873 Ikawa CFTR H. sapiens TCTGTATCTATATTCATCAT 58783 cut S. pyogenes 24954249 Yamamoto ...Yamamoto CREB1 H. sapiens GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1... OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt NFATc1 OZ543 and OZ544 OPEN OPEN aCCTCGCCTCagtgtGACGGAGGAc Swachmann-Bodian-Diamond...CODA CODA gCTCATCTCCACCGAGCTGGAGAAg atp2c1 OZ567 and OZ568 CODA CODA tTACCTCCACGATCTTGCTGATGGAg dio2 OZ569...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...gpcr-2037) OZ535 and OZ536 OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN...gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN... -
Immunology Research Plasmids and Resources
TypeCollection... calcineurin-dependent 1 MGC138448, NF-ATC, NFAT2, NFATc NFATC2 nuclear factor of activated T-cells, cytoplasmic... NFATX NFATC4 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4 NF-ATc4, NFAT3... KIAA0827, NF-AT5, NFATL1, NFATZ, OREBP, TONEBP NFATC1 nuclear factor of activated T-cells, cytoplasmic... -
CRISPR Guide
TypeCollection...direction. The location of any potential mismatches matters. Mismatches between the target sequence in the ...target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target ... seed sequence inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...contains the desired edit as well as additional DNA matching the sequence immediately upstream and downstream...resulting heteroduplex is resolved by the cell’s mismatch repair system. Alternatively, the edited 3’ flap... sgRNA directs Cas9n to a nearby site, driving mismatch repair using the edited strand as a template PE4... -
Synthetic Biology - Assembly Standards Guide
TypeCollection... 21) Prefix: GAATTC ATG AGATCT Prefix Enzymes: EcoR1 , BglII Suffix: T GGATCC TAA CTCGAG Suffix Enzymes...Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser in-frame with prefix start codon; Employs... -
CRISPR Plasmids - Plants
TypeCollection...pyogenes Hyg Chen 78098 pHAtC U6 AarI yes, cut S. pyogenes Hygro Kim 78097 pBAtC U6 AarI yes, cut S. pyogenes... -
Rett Syndrome
TypeCollection... for the development of successful therapeutics. ATCC - (Link opens in a new window) LUHMES cell line ...largest biorepositories (Link opens in a new window) ATCC - the world's largest cell line repository Tissue... -
Deisseroth INTRSECT Collection
TypeCollection...in the Periaqueductal Gray Facilitate the Itch-Scratching Cycle via Article Tac1-Expressing Neurons in ...in the Periaqueductal Gray Facilitate the Itch-Scratching Cycle via Descending Regulation. Neuron 101(1... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...sequences that minimize identical genomic matches or near-matches to reduce risk of cleavage away from target... -
Plan Your Experiment
TypeCollection...the selected target sequence. Additionally, any mismatches between a given gRNA sequence and your genomic...Method CRISPR Edit Type Additional Considerations Mismatch cleavage assay Knockouts Some point mutations ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...S. pyogenes Hyg Chen pHAtC 78098 Plant AarI yes, cut S. pyogenes Hygro Kim pBAtC 78097 Plant AarI yes,... -
CRISPR Plasmids - gRNAs
TypeCollection...choosing a gRNA: Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA...