...educational resources — including blog posts, protocols, guides, and collections — is a lot of material...plasmids and viral preps for catalog, blog posts and protocols for educational resources, and labs and institutions...

...Besides being compatible with any vector, the SLIC protocol itself is flexible. For one thing, those 5′ overhangs...Resources at Addgene Ligation-Independent Cloning Protocol Gibson Assembly Blog Post Choosing a Molecular...

...2017): 113-117. PubMed PMID: 28225754. 6. Marumoto, Tomotoshi, et al. "Development of a novel mouse glioma...

...Usually Destroyed Yes, Cpf1 cleaves 5' of the protospacer Multiplexing CRISPR-Cas9 options before Cpf1...Delivery Method Advantages Disadvantages References Yamamoto Lab Golden Gate Assembly transfection One vector...

...from the difficulty of developing an optimized protocol - it’s a bit like Goldilocks and the Three Steps...extra-methodical approach" to the top of your protocols when embarking on your ChIP journey!  References...

...you’re planning to go this route, check out our protocol video on using restriction digests to analyze ...Plasmids 101 series Find more molecular biology protocols and tips Resources on Addgene.org Learn more...

...well-suited for use in stem cells. (See the complete protocol at StemBook). Addgene: How are you now using this...TALEN on paper to a finished plasmid. With our protocol, it is feasible to produce genetically modified...

...free access articles on COVID-19 research. Protocols : Protocols that may be useful for COVID-19 research...published information and protocols for utilizing DETECTR to detect coronavirus - A protocol for rapid detection...Dataset (CORD-19) LitCovid (NCBI/PubMed) Protocols Protocols relevant to SARS-CoV-2 Research Coronavirus...Coronavirus Method Development Community at Protocols.io Addgene's Protocol for RNA Extraction Without A Kit References...linked to collections of open-access articles, protocols, and other resource collections related to COVID...Broad Institute has published information and protocols for utilizing SHERLOCK to detect coronavirus -...using CRISPR-Cas13: Open-access SHERLOCK research protocols and design resources (Link opens in a new window...

... RNA editing. Fast facts – PAM requirement: protospacer flanking sequence – A, U, or C. Best for: targeting...development and use. Fast facts – PAM requirement: protospacer flanking sequence – none. Best for: targeting...

...engineers in your lab, you likely will need to write protocols, SOPs, and methods sections. The next time you...academic labs when creating shared experimental protocols. Clarify: Asking for clarification during a meeting...

...a proxy for autophagy. Cells are cultured with isotope-labeled amino acids for several hours to several...Protein Oligomerization Seeing Red: Simple GFP Photoconversion Light Sheet Fluorescence Microscopy Additional...

... with most multi-labeling immunohistochemical protocols where either a directly labeled primary or a primary...secondary antibody. Compatible with multi-labeling protocols when other antigens are detected with either a...

... saves time and money when developing assays.  Protocol architecture The basic (very basic!) architecture...increased binding affinity, many indirect antibody protocols are designed to take place over multiple days....

...excitable. The mutants are co-expressed with a photoconvertible fluorescent protein mEOS4a. Cells containing...sensor that shows a favorable outcome are then photoconverted, sorted, and sequenced to identify the mutants...

...become slightly denatured during your experimental protocol, using a polyclonal antibody increases the likelihood...Antibody Purification and Storage. Cold Spring Harb Protoc 2019:pdb.top099101. https://doi.org/10.1101/pdb.top099101...

.... Use the "Contact info" link right below their photo. 2) Personalize all connection requests LinkedIn...for the picture. It tends to look like a police photo if you look straight at the camera. Pro tip: Turn...

...has  developed a proprietary, low cost cloning protocol that he has used for cloning of more than 10,000...plasmid elements Resources on Addgene.org Find protocols for plasmid cloning Read our molecular biology...

...FPs optimized for oxidizing environments to photoconvertible variants, it seems like GFP is always learning...delivered throughout the nervous system, including the motor cortex, cerebellum, and spinal cord. Cre-DOG is ...

... Their goal was to figure out how to optimize protocols for in vivo screening with lentiviral pooled shRNA... a lot of time packing, shipping, and sharing protocols one by one,” and she is excited to deposit the...

...24954249 Yamamoto HPRT1 H. sapiens TTATGCTGAGGATTTGGAAA 58771 cut S. pyogenes 24954249 Yamamoto IL1RN H...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table ...see article 69537 activate S. pyogenes 26352799 Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut ...TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes 24954249 Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut...TGACTTGCGAGGGACGCATT 58781 cut S. pyogenes 24954249 Yamamoto CDKN1B H. sapiens GAAGCCGGGACCTGGACCAG 60905 activate...