Skip to main content

We narrowed to 87 results for: otos

Showing: 1 - 20 of 87 results
  1. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...spatiotemporal serotonin release in vivo. bioRxiv 2023.05.27.542566. Yulong Li Serotonin Serotonin (5-HT) sensor...measuring serotonin dynamics. Nat Neurosci. 2021 Apr 5. Yulong Li , J. Julius Zhu Serotonin Serotonin sensor...00374-3. Lin Tian Serotonin Cilia-targeted serotonin sensor GRAB-HTR6 A serotonergic axon-cilium synapse...Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi: 10.1117...19(2):231-241. Tommaso Patriarchi Serotonin Red and green serotonin sensors GRAB_5-HT3.0 Dual-color GRAB...12. pii: S0092-8674(20)31612-3. Lin Tian Serotonin Serotonin (5-HT) sensor psychLight Psychedelic-inspired.... Eric Schreiter Calcium AAV expression of photoconvertible fluorescent protein-based calcium integrator...
  2. Viral Production

    Type
    Collection
    ...studies. Endotoxin contamination is minimized by using an endotoxin-free plasmid purification protocol. To ...gram-negative bacterial endotoxin is ensured to be less than 5 endotoxin units per mL. The endotoxin levels are determined...recombination rates in FLEX/DIO/fDIO constructs. Endotoxin Endotoxin contamination in vector preparations can ...distributed to customers. Details about our production protocols, titering methods, and quality control are described...elements and an internal control of known titer (protocol modified from Lock et al. (2014) (Link opens in...vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC). ... determined using a chromogenic endotoxin detection assay based on the amebocyte lysate method. Purity...
  3. Validated gRNA Sequences

    Type
    Collection
    ...24954249 Yamamoto HPRT1 H. sapiens TTATGCTGAGGATTTGGAAA 58771 cut S. pyogenes 24954249 Yamamoto IL1RN H...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table ...see article 69537 activate S. pyogenes 26352799 Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut...GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S. pyogenes 24954249 Yamamoto apoea D. rerio GGATGAGCCAAGAAGCCGCT 42241 cut ...TGAATTGGGATGCTGTTTTT 58779 cut S. pyogenes 24954249 Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut...TGACTTGCGAGGGACGCATT 58781 cut S. pyogenes 24954249 Yamamoto CDKN1B H. sapiens GAAGCCGGGACCTGGACCAG 60905 activate...
  4. CRISPR Plasmids - Tagging

    Type
    Collection
    ... Lab TAP Tagging Protocol 97.2 KB Yamamoto PITCh Tagging System The Takashi Yamamoto lab has deposited...provided their protocol for homology arm cloning: Mendenhall & Myers FETCh-seq Protocol 134.7 KB Mendenhall...can be found in Sakuma et al., Nature Protocols, 2016 . Yamamoto Tagging Plasmids: pX330S-2-PITCh - expresses...Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR...tagging techniques, as well as the plasmids and protocols needed for using them, are described below. Read...2014 The Förstemann lab has provided detailed protocols for N- or C-terminal tagging in Drosophila cells...locus in C. elegans . This system uses a 10-day protocol, generates “clean” homozygous mutants with no ...
  5. CRISPR References and Information

    Type
    Collection
    ...Feng Zhang Lab . Protocols Lab(s) Description Plasmids in protocol Download protocol Addgene CRISPR pooled...2014) (Link opens in a new window) . protoSpaceJAM protoSpaceJAM is an all-around platform for CRISPR ...cloning; injection protocol pU6-BbsI-chiRNA ; phsp70-Cas9 PDF, 109 KB Orkin and Bauer Protocol for Genomic Deletions...Resources CRISPR Software General Resources CRISPR Protocols Addgene CRISPR Resources CRISPR Plasmids Addgene's... (Link opens in a new window) A collection of protocols, materials, and publications by members of the... library amplification CRISPR pooled libraries Protocol at Addgene Church gRNA design and cloning gRNA...pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles Fly: gRNA and ssODNs...
  6. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ...or multicolor imaging. Photo-activatable iRFPs can be turned on by non-phototoxic far-red light and can...690/717 (after photoactivation) 3.2 pPAiRFP1-N1 PAiRFP2 692/719 (after photoactivation) 3.0 pPAiRFP2-N1... imaging using far red, near-infrared, and photoactivatable fluorescent proteins. Plasmid...Proteins: In Vivo Imaging Far-Red Near-Infrared Photoactivatable In vivo imaging is a powerful tool used to...imaging are derived from bacterial phytochrome photoreceptors (BphPs). Spectrally distinct fluorescent iRFP...piRFP720-N1 iSplit 690/713 5.3 pPAS-E and pK-GAFm Photoactivatable Protein Excitation/Emission Brightness Plasmids...
  7. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Gamma-protocadherin-A3 [N144/5R] Gamma-protocadherin-A3 Mouse Mouse IgG2a 222155 Gamma-protocadherin-B2 ...Mouse IgG2a 164156 Anti-Gamma-protocadherin-C3 [N174B/27R] Gamma-protocadherin-C3 Mouse Mouse IgG2a 164157... 177503 Anti-Pan-Gamma-protocadherin-Constant [N159/5R] Pan-Gamma-protocadherin-Constant Mouse IgG2a 177504...IgG2a 182105 Anti-Pan-Gamma-protocadherin-A [N144/32R] Pan-Gamma-protocadherin-A Mouse IgG2a 182106 Anti-Histone...Mouse IgG2a 190299 Anti-Gamma-protocadherin-B2 [N148/30] Gamma-protocadherin-B2 Mouse Mouse IgG2a 190300...Mouse IgG2a 199398 Anti-Gamma-protocadherin-A3 [N144/17R] Gamma-protocadherin-A3 Rat Mouse IgG2a 199399 Anti-PINK1...Pan-Gamma-protocadherin-Constant recombinant mouse monoclonal antibody. Pan-Gamma-protocadherin-Constant...
  8. Optogenetics AAV Preps

    Type
    Collection
    ...pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE CamKII ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Karl Deisseroth...pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE Syn ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Karl Deisseroth...pAAV-Ef1a-DIO-ChRmine-mScarlet-WPRE EF1a ChRmine (high-photocurrent, red-shifted) mScarlet Cre dependent 1, 5 Karl... 6m-p2A-ChRmine-Kv2.1-WPRE Syn ChRmine (high-photocurrent, red-shifted) GCaMP6m Constitutive 8 Karl Deisseroth... pAAV-nEF-ChRmine-mScarlet nEF ChRmine (high-photocurrent, red-shifted) mScarlet Constitutive 8 Karl Deisseroth...pAAV-nEF-Con/Fon-ChRmine-oScarlet nEF ChRmine (high-photocurrent, red-shifted) oScarlet Cre and Flp dependent...-Coff/Fon-ChRmine-oScarlet nEF ChRmine (high-photocurrent, red-shifted) oScarlet Flp dependent 8 Karl ...
  9. Genetic Code Expansion

    Type
    Collection
    ...Kensaku Sakamoto 197099 pIYN3 TyrRS M. jannaschii halogenated tyrosines Bacterial TAG Kensaku Sakamoto 197100...Kensaku Sakamoto 197101 pCDF-Az TyrRS M. jannaschii azidophenylalanine Bacterial TAG Kensaku Sakamoto 197102...you are working off of a previously established protocol, make sure to match the growth medium, ncAA concentration... pMAH2-CageCys leucyl-tRNA-synthetase E. coli photocaged cysteine Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS...91705 pSupAR-MbPylRS(DiZPK) PylRS M. barkeri photocrosslinkers DiZPK, DiZSeK, or DiZHSeC Bacterial TAG P....91706 pCMV-MbPylRS(DiZPK) PylRS M. barkeri photocrosslinkers DiZPK, DiZSeK, or DiZHSeC Mammalian TAG P.... PylT_FLAG-AbKRS-chIPYE chimeric PylRS Chimeric photo-crosslinking-lysine Mammalian TAG Simon Elsaesser...
  10. Ras Pathway

    Type
    Collection
    ...Serine/threonine kinases: A-Raf proto-oncogene B-Raf proto-oncogene Raf-1 proto-oncogene RAL RALA RALB v-ral...substrate JUN Jun proto-oncogene KSR KSR1 KSR2 Kinase suppressor of ras MDM2 MDM2 proto-oncogene MEK MAP2K1...Mitogen-activated protein kinase ETS ETS1 ETS2 ETS proto-oncogene, transcription factor EXOC EXOC1 EXOC2 ...Mitogen-activated protein kinase kinase MET MET proto-oncogene, receptor tyrosine kinase MLST8 MTOR associated... coiled-coil containing protein kinase ROS1 ROS proto-oncogene 1, receptor tyrosine kinase RPS6KA RPS6KA1...
  11. Zhang Lab CRISPR Page

    Type
    Collection
    ...Nature Protocols 2013). For cloning information, please view: Zhang Lab General Cloning Protocol 237.2 ...amplicons using a protocol similar to SpCas9 sgRNA PCR (Ran et al., Nature Protocols 2013). SpCas9 Cas9...Website You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts Jump to: SpCas9...co-transfected as PCR amplicons (Ran et al., Nature Protocols 2013). Individual human codon-optimized SpCas9...insertion of guide sequences Zhang Lab SAM Cloning Protocol 321.5 KB Return to top AAV - In vivo Genome Editing...cloning information: CRISPR-Cas9 mouse toolbox protocol 637.8 KB CRISPR-Cas9 Cre expression vectors for...PD, Wright J, Agarwala V, Scott DA, Zhang F. Nat Protoc . 2013 Nov;8(11):2281-308. doi: 10.1038/nprot.2013.143...
  12. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ...Resources A detailed protocol for practicing OPEN is available in the 2009 Joung Nature Protocols paper . How ... Scot Wolfe Lab plasmids Detailed Information Protocols & Resources Contents of Kit Original Publication...Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays. Maeder...Thibodeau-Beganny S, Sander JD, Voytas DF, Joung JK. Nature Protocols . 2009;4(10):1471-501. doi: 10.1038/nprot.2009.98...
  13. Antibody Production

    Type
    Collection
    ...For more details on protocols see the Addgene Protocols page or the Neuromab Protocols (Link opens in a ...are initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is...before distribution. Details about our production protocols, titering methods, and quality control are described...Recipient Instructions Addgene Help Center Antibody Protocols...
  14. Plasmids for Stem Cell Research

    Type
    Collection
    ...activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human Sox2, Nanog... doi: 10.1038/nature10323. Crabtree Fibroblasts Motor Neurons Retroviral Mouse/Human Conversion of mouse...mouse and human fibroblasts into functional spinal motor neurons. Cell Stem Cell. 2011 Sep 2;9(3):205-18....2015 Nov 5;17(5):543-56. Buganim Skin Fibroblasts Motor Neurons Lentiviral Human Direct Lineage Reprogramming...Reprogramming Reveals Disease-Specific Phenotypes of Motor Neurons from Human ALS Patients. Cell Rep. 2016 Jan...2023(15)30159-6. Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-...Differentiation of Human iPSCs into Neurons. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. Next generation ...
  15. Microbiology Resources

    Type
    Collection
    ... cerevisiae - Dueber Lab Yeast Prototrophy : Restoration of prototrophy in common S. cerevisiae lab strains...microbe of interest, including bacteria, viruses, protozoa, fungi, and more. Plasmid...including bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below for the species...Cryptococcus sp. Plasmids for Prions Prions Plasmids for Protozoa Species Entamoeba histolytica Leishmania sp. Plasmodium... page for CRISPR resources, such as depositor protocols and gRNA design software. Addgene yeast CRISPR...
  16. Immunology Research Plasmids and Resources

    Type
    Collection
    ...hydroxytryptamine (serotonin) receptor 3B 5-HT3B HTR3C 5-hydroxytryptamine (serotonin) receptor 3, family...RIFLE, TAL LTA lymphotoxin alpha (TNF superfamily, member 1) LT, TNFB, TNFSF1 LTB lymphotoxin beta (TNF superfamily...member 1 CD94 LGMN legumain AEP, LGMN1, PRSC1 LTA lymphotoxin alpha (TNF superfamily, member 1) LT, TNFB, TNFSF1... RNase A family, 2 (liver, eosinophil-derived neurotoxin) EDN, RNS2 ROBO1 roundabout, axon guidance receptor...3 HIS2, HTN2, HTN5 HTR3A 5-hydroxytryptamine (serotonin) receptor 3A 5-HT-3, 5-HT3A, 5-HT3R, 5HT3R, HTR3...family member C - HTR3D 5-hydroxytryptamine (serotonin) receptor 3 family member D MGC119636, MGC119637 ...MGC119637 HTR3E 5-hydroxytryptamine (serotonin) receptor 3, family member E 5-HT3c1, MGC120035, MGC120036, MGC120037...
  17. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...contains many unique protospacer sequences that have homology to foreign DNA. Protospacers are separated by...Engineering You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR...contain a species-specific sequence known as a protospacer adjacent motif (PAM). The CRISPR complex binds...sequence is only valid if it contains a special Protospacer Adjacent Motif (PAM) directly after where the...target RNA rather than DNA, sometimes requiring a protospacer flanking sequence (PFS). In bacteria, Cas13 targeting...further develop the CRISPR toolkit by posting lab protocols , providing tips from experts in the field, and...
  18. Brain Initiative Collection

    Type
    Collection
    ...pAAV-CAG-iSeroSnFR-Nlgn Fluorescent reporter for serotonin (dendrite localization tag) Lin Tian 135420-AAV1...parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades...parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades...frame with EGFP under control of human synapsin1 promotor. Ofer Yizhar 198513-AAV5 pAAV_hSyn-PdCO-EGFP-WPRE...frame with EGFP under control of human synapsin1 promotor. Ofer Yizhar 198516-AAV1 pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE...optimized PdCO under control of human synapsin1 promotor after Cre-dependent recombination Ofer Yizhar ...
  19. COVID-19 Resources

    Type
    Collection
    .... Other Resources Protocols Coronavirus Method Development Community at Protocols.io (Link opens in a ...new window) Addgene's Protocol for RNA Extraction Without A Kit Bloom lab - Protocol and Reagents for Pseudotyping...linked to collections of open-access articles, protocols, and other resource collections related to COVID... Spike Protein Nemazee lab - Pseudotyped virus protocol for coronaviruses (DOCX, 184 KB) Research Articles...
  20. CRISPR Guide

    Type
    Collection
    ...edition) CRISPR software and depositor protocols Video protocol for genomic deletions in mammalian cell...target is present immediately adjacent to a P rotospacer A djacent M otif (PAM) The PAM sequence (NGG)...can increase the risk of off-target cutting or cytotoxicity, but naturally-occurring Acr (Anti-CRISPR) proteins...fusing the anti-CRISPR protein AcrIIA4 with the photosensitive LOV2 domain . Several labs have also controlled...before use (Figure 8C), following the amplification protocol specified by the depositing lab. After amplification...The translated codons that make up a gene PAM P rotospacer A djacent M otif; Sequence adjacent to the target...engineering using the CRISPR-Cas9 system. Nature Protocols , 8 (11), 2281–2308. PMID: 24157548 Ran, F. A....
Showing: 1 - 20 of 87 results