Skip to main content
Addgene
Showing: 281 - 300 of 556 results

  1. The 10 Most Distributed Plasmid Technologies in Addgene's First 10 Years

    Type
    Blog Post
    ...our collection. CRISPR/Cas9 - At Addgene, 2013 will be known as the "Year of the CRISPR." The newest genome...many different purposes that we had to create a CRISPR page to keep up with all the new plasmids. So far... far, we have distributed over 10,000 CRISPR/Cas9 plasmids to more than 3,000 labs around the world. ...

  2. Addgene at the ASM Microbe 2016 Conference

    Type
    Blog Post
    ...applying temporary tattoos on the spot with our trusty spray bottles! We also raffled off one of our highly sought-after...morning, John Doench’s opening presentation at the CRISPR screens symposia outlined the fantastic work this... Institute lab is doing creating well-optimized CRISPR screening technology. Addgene got several shout-outs...Use Addgene's Microbiology Pages Read Our Post on CRISPR Methods for Bacterial Genome Engineering Learn ...

  3. Ras Pathway

    Type
    Collection
    ...factor SPRED SPRED1 SPRED2 SPRED3 Sprouty related, EVH1 domain containing SPRY SPRY1 SPRY2 SPRY3 SPRY4 ...SPRY4 Sprouty RTK signaling antagonist STK STK3 STK4 Serine/threonine kinase STK11 Serine/threonine kinase...

  4. Using Addgene's New Viral Service for Your Research

    Type
    Blog Post
    ...Service, we’re distributing lentivirus (with many CRISPR tools included among the preps that are currently...lentiviral vectors in the repository are used to produce CRISPR tools, we’re starting the Viral Service with lentiviral... activators, Cas9 repressors, select gRNAs, and CRISPR pooled libraries. Whether you’d like to knockout... in experiments other than just those involving CRISPR and so we also have lentivirus for delivering control...

  5. Addgene-Seeding Labs plasmid grant round 3: microbial drug resistance and biofilms, antidiabetic plant components, visualizing brain injury - and a glowing robot fish

    Type
    Blog Post
    ...Resources at Addgene.org Check out our CRISPR resources and CRISPR for plants Bacterial Expression Systems...PZA-resistance by using different approaches, including CRISPR and recombination-mediated genetic engineering ...more information on bacterial engineering using CRISPR on our blog). Her research should provide us with...

  6. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...

  7. Addgene: The First Twenty Years

    Type
    Blog Post
    ...And when CRISPR arrived in 2012, our repository was rapidly able to support sharing of CRISPR constructs....org/guides/crispr/” — SirHamhands, responding to a request for “any suggestion for CRISPR online course...

  9. Plasmids 101: Modular Cloning

    Type
    Blog Post
    ...assemble and test many variables all at once. CRISPR CRISPR arrays and libraries depend on many gRNAs delivered...etc. MoClo is especially useful for more complex CRISPR experiments (e.g., many guides/parts delivered)...delivered) in certain model organisms. In mammals, most CRISPR libraries are assembled and delivered virally, ...

  10. Adapting Toehold Switches to Detect Zika Virus

    Type
    Blog Post
    ...important role in helping to monitor and slow this spread until vaccine programs can be put in place to provide... people globally live in areas conducive to the spread of the virus by the Aedes mosquito (Messina et ...done as quickly as we could. From the outset, we spread out the risk for the project by initially designing... RNA amplification, new toehold switch designs, CRISPR/Cas9-mediated genotyping, as well as our electronic...

  11. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Anti-CASPR/Neurexin IV [K65A/2R] CASPR/Neurexin IV Mouse IgG2a 206606 Anti-CASPR2 [K67/11R] CASPR2 Human...177445 Anti-CASPR/Neurexin IV [K65/35R] CASPR/Neurexin IV Rat Mouse IgG2a 177446 Anti-CASPR2 [K67/25R] ...219448 Anti-CASPR/Neurexin IV [K65A/30R] CASPR/Neurexin IV Rat Mouse IgG2a 219449 Anti-CASPR/Neurexin IV...SAP97 Rat Mouse IgG2a 128625 Anti-CASPR/Neurexin IV [K66/38R] CASPR/Neurexin IV Rat Mouse IgG2a 128626...VAPA Rat Mouse IgG2a 199403 Anti-CASPR/Neurexin IV [K65/35R-2b] CASPR/Neurexin IV Rat Mouse IgG2b 199404...external) Human Mouse IgG1 206683 Anti-CASPR/Neurexin IV [K65/35R-1] CASPR/Neurexin IV Rat Mouse IgG1 206684...K28/77R] PSD-95 Human Mouse IgG2a 220381 Caspr [K65/31R] Caspr Rat Mouse IgG2a 220382 KChIP3 K+ channel...

  13. Antibiotic Resistance: An Old Solution but a New Problem

    Type
    Blog Post
    ...recent blog post on CRISPR antimicrobials to learn how scientists are using CRISPR to fight bacteria. ...from getting sick can be helpful in preventing the spread of antibiotic resistant bacteria from one person...For more information and tips on preventing the spread of antibiotic resistant bacteria, check out this...

  14. Advancing Biology with Zebrafish: Genetic Tools for Developmental Studies and More

    Type
    Blog Post
    ...zinc-finger nucleases, TALENs, and more recently CRISPR/Cas9. Another popular targeted gene deactivation...developed, relying on established reagents such as CRISPR/Cas9, Tol2, and the high-quality sequenced zebrafish...systems, and their resistance (so far) to facile CRISPR/Cas9-mediated insertion of foreign DNA. Despite... Resources on Addgene.org Browse our zebrafish CRISPR plasmid collection Read our molecular biology reference...

  15. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...organism.   It’s not an overstatement to say that CRISPR/Cas9 editing is one of the key tools now providing...to mate with and if she decides to raise their offspring or leave them to their own devices. Chytrid fungi...clutch of eggs? Propagation is thus quite difficult. CRISPR genome editing in squid is possible nonetheless...reptiles at all. But new success is coming with CRISPR/Cas in lizards. The Menke Lab was able to make ...

  16. Twenty Years of Sharing: Expanding Accessibility

    Type
    Blog Post
    ...Educational Resource Top Five by Views Guides CRISPR Guide Lentiviral Guide AAV Guide Optogenetics Guide... What is a Plasmid? How to Design Your gRNA for CRISPR Editing The Promoter Region - Let's Go! How to ...primers to help users get started with tools like CRISPR, lentivirus, and optogenetics — and shared the ...Addgene blog Twenty Years of Addgene Sharing: CRISPRTwenty Years of Sharing: Addgene's Viral Vector Service...

  17. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...increasing the size of the AAV donor template for CRISPR-mediated homology directed repairs (HDR). Split...sequential homology directed repairs (HDR) with CRISPR/Cas9. Donor A contains: 400bp homology arms to ...single step and serve as donors for two consecutive CRISPR-mediated HDR events which results in the integration....org/10.1172/jci34316 Bak RO, Porteus MH (2017) CRISPR-Mediated Integration of Large Gene Cassettes Using...

  18. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ...technique is also highly relevant in this age of CRISPR; site-directed mutagenesis generally applies to...DNA through homology-directed repair (HDR) of a CRISPR/Cas9 induced double-stranded break. This site-directed...a similar approach can be used to identify Cas9/CRISPR-induced genome modifications. Occasionally, multimerization...More about Plasmids in Our Plasmids 101 Series Use CRISPR to Generate Specific Genomic Mutations Resources...

  19. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ... receptor interactions of a serotype can affect spread from the injection site  (Kanaan et al., 2017),... al., 2020). For example, AAV1 and AAV9 tend to spread farther from the injection site than AAV2 (Watakabe...serotype you’ve picked, since that can affect the spread of the virus.  A better way to define high titer...AAV Capsids Improve Transduction and Volumetric Spread in the CNS. Molecular Therapy - Nucleic Acids, ...

  20. COVID-19 Resources

    Type
    Collection
    ...Lab Cas12a plasmids Addgene's full CRISPR guide and summary of CRISPR pooled libraries . FlipGFP-based ...coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access SHERLOCK research protocols ...develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has... of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR (Link opens in ...now available from Ray Owens' lab. Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and...181(4):865-876.e12. (Link opens in a new window) CRISPR tools and reporters now available from Stanley ...Collection Science Journals Coronavirus Collection Springer Nature SARS-CoV-2 and COVID-19 Articles Wiley ...
Showing: 281 - 300 of 556 results