...trimers, tetramers). Since then, multimerization has been observed to occur in many different kinds of...sequences. In some specific cases, multimerization has been observed to occur more frequently in plasmids... Ausubel, 1976). In fact, if your plasmid sample has a mix of different-sized multimers, you may even ...~3.6 kb and ~1.1 kb (lane 3). Uncut DNA (lane 2) has a band at <3 kb, which corresponds to the supercoiled...multimers is capillary gel electrophoresis (CGE), which has been used in plasmid vaccine and gene therapy development...

...within the human genome. Another variant, xCas9 3.7 has 7 mutations found in the REC2, REC3, and PAM interacting...CRISPR toolbox The isolation of novel CRISPR proteins has and will continue to dramatically increase the number...additional targeting flexibility. Cas13a (formerly C2c2) has been adapted for targeted RNA cleavage in mammalian... MH, Tang W, Chen L, Sun N, Zeina CM, Gao X, Rees HA, Lin Z, Liu DR (2018) Evolved Cas9 variants with ...

...never went away. While he has frequent bouts with Impostor Syndrome, Joe has found his people through ... match people within similar fields (ASM Microbe has eight tracks), something we didn’t have enough people...notebook paper, despite the fact that it was gray. He has worked in molecular and microbiology for the last...

...as a scientist has been building your creativity all along. In my own career, my team has used these techniques...and instead building an environment where everyone has their ideas heard.  So how can we assure that all...continue advocating for your idea. Our product team has implemented a policy of never rejecting an idea simply...

...optical pooled CRISPR screening, Paul Blainey’s lab has developed a multiplexing approach to Cas9-based pooled... stabilize the 3’ end of the pegRNA. As research has just begun with PE7, it will be exciting to see future...conferred several new improvements. The new variant has increased signal-to-noise ratio and better ability...limitations of traditional AAVs, the Becirovic Lab has developed REVeRT, for gene delivery using reconstitution...

...right corner.      Figure 2: This flow plot has two populations that are B+ and one population that...Figure 3 above, until the population of interest has been successfully identified and isolated.  Following...from Boix et al., 2018, uses quadrants to gate and has numbers representing the percentage of cells in each...2017). Neonatal immune response to rhinovirus A16 has diminished dendritic cell function and increased ...

...epitope (GKPIPNPLLGLDST) has been used as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile...like PROTAC targeted protein degraders. But CRBN has been difficult to study in vitro, requiring either...Cas9 system By Aryana Khosravani Deborah Hung’s lab has developed a novel dual-plasmid CRISPR/Cas9 system...

...The Rett Syndrome Research Trust (RSRT) has an ambitious goal of curing Rett Syndrome and Addgene is ....  As a non-degenerative, monogenic disease that has shown reversibility of symptoms in animal models,...neuronal subtypes of the hippocampus. This technology has formed the basis of the Rett syndrome program being....1138389 Le TTH, Tran NT, Dao TML, Nguyen DD, Do HD, Ha TL, Kühn R, Nguyen TL, Rajewsky K, Chu VT (2019) ...

...kD TurboID, which has 15 mutations compared to BirA and the 28kD miniTurbo, which has the N-terminus domain...proteins in minutes rather than hours like BioID. APEX has allowed scientists to identify the proteomic map ...BioID was developed in 2012, proximity labelling has become a powerful technique for studying protein-...

...time in grad school. As you'll learn, grad school has its ups and downs for everyone but you can come out...their grad student communities 5:59 - 8:16 : What has made you unhappy in grad school? As part of this ...

... undermine critical research infrastructure that has taken decades to establish.These funding decisions...Together Throughout history, the scientific community has demonstrated remarkable resilience and creativity...

...repository, and getting feedback from our community. It has been great to hear all the words of support from ...from scientists using Addgene in their labs. And it has been exciting to learn about all the amazing research...

...of just how big and mainstream the news on CRISPR has gotten, consider these headlines in The New York ...New York Times feature when he said, “All of this has basically happened in a year. It’s incredible.” ...

...radioactive tracer. As a solution, Mikhail Shapiro’s lab has developed four acoustic reporter gene (ARG) plasmids...connection between specific genes and an immune response has been a longstanding challenge. Using shRNA, TALEN... for in vivo functional analysis of immune cells has been a gap in the field. Arlene Sharpe’s group at...

...in vivo scientists need a protease reporter that has a large dynamic range and high brightness. The Shu...in the midgut of Drosophila, an observation that has been difficult until now (Zhang et al., 2019). Conclusion...Conclusion FlipGFP is a novel fluorogenic reporter that has a large dynamic range and high brightness. This reporter...

...impressed with is the level of proficiency that Addgene has developed in terms of the collection, storage, and... What is the best piece of career advice someone has given you? Katz: Pick up the phone. I think that ... insurance, finance and high-tech industries. He has earned both an MBA in finance and a B.S. in accounting...

...15 years of plasmid sharing has certainly taken us on many adventures...From moving office locations ...plasmids are from the Zhang lab. In fact, the Zhang lab has shared over 40,000 CRISPR-Cas9 components over the...Chimeric_BB-CBh-hSpCas9 - The S. pyogenes Cas9 (SpCas9) has been widely popular in genome engineering. For use...

...Adenovirus is a linear, dsDNA virus naturally. It has ITRs, just like AAV, which encompass the expression...packaging and entry Adenovirus is quite large and has more helper plasmid components than the other viruses...of adenovirus Building viral vectors Addgene has many viral vectors and helper plasmids for all the...

...restricted based on experimental constraints. This has been used for a wide range of purposes, including...Cre-containing adenovirus (Ad-Cre) or AAV (AAV-pgk-Cre) has been used to successfully introduce Cre into cells... can be an effective alternative to Cre-lox, and has also been used in conjunction with it, allowing for...

...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...