...DNA that already has restriction sites on either side of it into any plasmid that has the same sites in...clonase (creating an entry clone). The entry clone now has recombined attL sites flanking your DNA fragment ...fragment of interest. Now that your DNA fragment has been cloned into a donor plasmid, it can be rapidly shuttled...into a donor plasmid (or acquire one that already has your gene into it) and then using bacterial recombination..., such as restriction cloning, once your project has been completed via gateway cloning. Back to Top TOPO...pre-cut, linear, cloning ready TOPO® vectors that has a DNA topoisomerase I fused to the 3’ end. The topoisomerase...base pairs. Anything shorter than 200 base pairs has the potential to be completely chewed back by the...

...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...

...Receptor (CAR) to enter cells. Recombinant adenovirus has two genes deleted: E1 and E3. E1 is supplied by the... digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that...AdEasy™ System? The laboratory of Bert Vogelstein has published their method for generation of recombinant...

...studies, however, it has off-target effects. The atypical antipsychotic drug olanzapine has also been shown...is based on the human M3 muscarinic receptor and has not been used in vivo . Figure 2: DREADDs, their ...for muscarinic-receptor based DREADDs. Compound 21 has similar potency as CNO, while DCZ is more potent ...attractive alternatives for experiments. Perlapine has been previously used in human populations in Japan...luciferase-fluorescent protein fusions, to more-sensitive opsins has led to improved LMOs with increased efficiencies....

.... Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one inactivated one... available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while... SpCas9. FrCas9 (from Faecalibaculum rodentium ) has increased fidelity, and recognizes NNTA, a PAM sequence... create the adenine base editor. The TadA domain has also been further evolved to catalyze cytidine deamination...editing requires more optimization and typically has lower efficiency (< 50%) than base editing (> 90%...modifications to eliminate target gene function. It has also been used extensively to screen for novel genes... those for yeast or drosophila . Although CRISPR has been less widely used in bacteria due to technical...

... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...

...turning on and off the light source. Optogenetics has been broadly applied to study the physiology of the...channel. ChR2 is preferred over ChR1 because ChR2 has higher conductance at physiological pH and trafficks...Depolarizing) ChR Variants. The optogenetic toolbox has been expanded by scientists through both the identification...heterodimerization can reconstitute the protein. This principle has also permitted the design of synthetic two-part transcription...

...gamma-retroviruses) in cancer and stem cell research has prompted the development of multiple virus packaging...components found within the backbone. For example: pLXSN has the wild type L TR, an MCS for cloning X gene, an...

... generation systems because the packaging vector has been divided into two separate plasmids (resulting... transcription of the full-length virus after it has incorporated into a host cell. The potential for ...practices with regard to lentiviral research. The NIH has additional information on lentiviral safety considerations...

...isolating one specific DNA sequence. This obstacle has been overcome by the field of recombinant DNA technology...isolates, the K-12 strain and the B strain. K-12 has led to the common lab strains MG1655 and its derivatives...polymerase. Thus to replicate a piece of DNA in vitro one has to know some of its sequence to design a effective...Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...

... Science Guides Addgene has created the following guides to help you start learning...

...Toronto KnockOut (TKO) library from the Moffat lab has over 175,000 different gRNA-containing plasmids)....

...Addgene. The popular CRISPR/Cas9 genome editing system has been modified for use with AAV; this system represents...

...NHEJ. How do you determine that your desired edit has occurred? The exact method necessary to validate ...