Skip to main content

We narrowed to 14 results for: HA

Showing: 1 - 14 of 14 results
  1. Cloning

    Type
    Guide
    ...DNA that already has restriction sites on either side of it into any plasmid that has the same sites in...clonase (creating an entry clone). The entry clone now has recombined attL sites flanking your DNA fragment ...fragment of interest. Now that your DNA fragment has been cloned into a donor plasmid, it can be rapidly shuttled...into a donor plasmid (or acquire one that already has your gene into it) and then using bacterial recombination..., such as restriction cloning, once your project has been completed via gateway cloning. Back to Top TOPO...pre-cut, linear, cloning ready TOPO® vectors that has a DNA topoisomerase I fused to the 3’ end. The topoisomerase...base pairs. Anything shorter than 200 base pairs has the potential to be completely chewed back by the...
  2. Adenovirus Guide

    Type
    Guide
    ...response quickly, which has limited their use in therapeutic applications. However, this has also made them the...the human population has been exposed to at least one human AdV serotype and has developed a serotype-...immune response has become a disadvantage for the use of rAdV vectors in gene therapy but has, however, proven... digest patterns to determine that the transgene has been inserted into the adenoviral backbone plasmid...other immune-modulatory molecules. Another strategy has been to use oncolytic rAdV vectors, which are replication-competent... of spontaneous reversion to RCAs, although this has been reduced by providing the E1 gene in trans within... adenovirus (RCA) Mutated adenoviral vector that has the ability to replicate and reproduce within host...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...genome can occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending... well-characterized and extensively studied, and has a broad tissue tropism. Table 1 gives a summary of...across a broad range of cell types in vivo. AAV-DJ has been optimized further for specific cell and tissue... tropism towards specific cell types of interest has been to create and test capsid libraries with random...systemic capsids. A systemic capsid is a capsid that has been engineered to have enhanced function after intravenous...naturally cross the BBB. The Viviana Gradinaru lab has developed a number of systemic rAAV vectors that ...preps . AAV retrograde (AAVrg) Directed evolution has also been employed to engineer an rAAV serotype variant...
  4. Sequencing Primers

    Type
    Guide
    ...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse...Reference Sequencing Primers Sequencing Primers Addgene has used a number of primers for sanger sequence verification...
  5. Chemogenetics Guide

    Type
    Guide
    ...studies, however, it has off-target effects. The atypical antipsychotic drug olanzapine has also been shown...is based on the human M3 muscarinic receptor and has not been used in vivo . Figure 2: DREADDs, their ...for muscarinic-receptor based DREADDs. Compound 21 has similar potency as CNO, while DCZ is more potent ...attractive alternatives for experiments. Perlapine has been previously used in human populations in Japan...luciferase-fluorescent protein fusions, to more-sensitive opsins has led to improved LMOs with increased efficiencies....
  6. CRISPR Guide

    Type
    Guide
    .... Cas9 nickase (Cas9n), a D10A mutant of SpCas9, has one active nuclease domain and one inactivated one... available. SaCas9 (from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while... SpCas9. FrCas9 (from Faecalibaculum rodentium ) has increased fidelity, and recognizes NNTA, a PAM sequence... create the adenine base editor. The TadA domain has also been further evolved to catalyze cytidine deamination...editing requires more optimization and typically has lower efficiency (< 50%) than base editing (> 90%...modifications to eliminate target gene function. It has also been used extensively to screen for novel genes... those for yeast or drosophila . Although CRISPR has been less widely used in bacteria due to technical...
  7. Antibody Guide

    Type
    Guide
    ... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...
  8. Optogenetics Guide

    Type
    Guide
    ...turning on and off the light source. Optogenetics has been broadly applied to study the physiology of the...channel. ChR2 is preferred over ChR1 because ChR2 has higher conductance at physiological pH and trafficks...Depolarizing) ChR Variants. The optogenetic toolbox has been expanded by scientists through both the identification...heterodimerization can reconstitute the protein. This principle has also permitted the design of synthetic two-part transcription...
  9. Lentiviral Vector Guide

    Type
    Guide
    ...Retroviridae family. Infection with lentiviruses has a long incubation period that eventually leads to... genes, mutations, or treatments into cells, and has been widely used in the research community for decades...VSV-G is by far the most common envelope gene, as it has a wide range of infectivity across many cell types...their stable expression and wide tropism. Addgene has an extensive collection of lentiviral CRISPR libraries...
  10. Molecular Biology Reference

    Type
    Guide
    ...isolating one specific DNA sequence. This obstacle has been overcome by the field of recombinant DNA technology...isolates, the K-12 strain and the B strain. K-12 has led to the common lab strains MG1655 and its derivatives...polymerase. Thus to replicate a piece of DNA in vitro one has to know some of its sequence to design a effective...Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...
  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... genes, mutations, or treatments into cells, and has been widely used in the research community for decades...VSV-G is by far the most common envelope gene, as it has a wide range of infectivity across many cell types...promoter; the transcript begins at the beginning of R, has a 5' cap structure, and proceeds through U5 and the...
  12. Science Guides

    Type
    Guide
    ... Science Guides Addgene has created the following guides to help you start learning...
  13. Guide to Using Pooled Libraries

    Type
    Guide
    ...Toronto KnockOut (TKO) library from the Moffat lab has over 175,000 different gRNA-containing plasmids)....
  14. Plan Your Experiment

    Type
    Guide
    ...contain your desired edit. Each of these methods has their own considerations. Which one to use will come...
Showing: 1 - 14 of 14 results