Skip to main content

We narrowed to 451 results for: crispr

Showing: 321 - 340 of 451 results
  1. Distribution to Industry

    Type
    Collection
    ...Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9-mediated saturation...Fusions from Promega COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson...
  2. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...
  3. AAVs in Retinal Gene Therapy

    Type
    Blog Post
    ...trials for prevalent diseases - to name a few. CRISPR-based tools are also particularly well suited to.... Yu W and Wu Z., 2018. In vivo Applications of CRISPR-Based Genome Editing in the Retina. Front Cell ...
  4. Hot Plasmids: Summer 2025

    Type
    Blog Post
    ... TnpB, so hot right now By Alyssa Shepard While CRISPR has become a household name, the search for smaller...more in our recent blog post on TnpB). Similar to CRISPR-Cas, TnpB is directed to genomic targets using ...
  5. Addgene’s Blog Gets a New Look!

    Type
    Blog Post
    ...showcases the five main topics of the blog: Plasmids CRISPR Viral Vectors Fluorescent Proteins Science Careers...
  6. Twenty Years of Sharing: Addgene's Viral Vector Service

    Type
    Blog Post
    ... may recall our first 20th anniversary story on CRISPR, where we dove fairly deeply into the different...Practical Considerations for Using Pooled Lentiviral CRISPR Libraries. Current Protocols in Molecular Biology...
  7. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Tumor Suppressor Gene CRISPR Knockout Library CRISPR Sidi Chen Use this AAV CRISPR knockout library expressing...Plasmid Collection Monosynaptic Neuronal Tracing CRISPR Plasmids and Resources Content last reviewed on...
  8. Editor's Choice, September 2016

    Type
    Blog Post
    ...Needed to Navigate a Scientific Enterprise in Flux CRISPR Kinome Libraries Available: Pooled and Individual...
Showing: 321 - 340 of 451 results