Addgene

We narrowed to 374 results for: Lor;

Showing: 361 - 374 of 374 results

Results per page:

Deep Dive: Statistical Tests (Comparisons)

Type

Blog Post

...SMJ.0b013e3182498ad5 Curran-Everett, Douglas. Explorations in statistics: statistical facets of reproducibility...
Plasmids 101: Using Transposons in the Lab

Type

Blog Post

...first discovered transposons due to changes in coloration of corn kernels. Aside from corn, transposons...
Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)

Type

Blog Post

...for Designing Primers UCSC Genome Browser: For eploring genomic DNA ImageJ: Free Software for Analyzing...
Important Considerations When Using AAVs

Type

Blog Post

...171-182. PubMed PMID: 17328683. 11. Wouterlood, Floris G., et al. "A fourth generation of neuroanatomical...
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

Type

Blog Post

...the haystack” type of problem and led to me to explore alternate approaches. Being a “lazy” geneticist...
Plasmids 101: Modular Cloning Applications and Kits

Type

Blog Post

...https://doi.org/10.1021/acssynbio.3c00167. Hahn, Florian, et al. “A Modular Cloning Toolkit for Genome Editing...
Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

Type

Blog Post

... by 750 nm to 760 nm laser light, enabling dual color imaging studies with blue or cyan proteins without...
Special Delivery: Fluorophore Targeting for FRET Studies

Type

Blog Post

... Degorce, François, et al. "HTRF: a technology tailored for drug discovery–a review of theoretical aspects...
CRISPR 101: Cytosine Transversion Editors

Type

Blog Post

...apyrimidinic sites and abbreviated as AP sites. To explore this further, the team started engineering a CBE...
CRISPR 101: Multiplex Expression of gRNAs

Type

Blog Post

...below. Figure 2: gRNA target sequences (colored rectangles) are cloned into various plasmids using...
Troubleshooting and Optimizing a Western Blot

Type

Blog Post

...need such precise measurements, you can use a colorimetric ladder, visible to the naked eye; a fluorescent...
Viral Vectors 101: Systemic Capsids

Type

Blog Post

...intravenous delivery by directed evolution of underexplored sites on the AAV capsid. Molecular Therapy -...
Adeno-associated virus (AAV) Guide

Type

Guide

...short coding sequences of channelrhodopsins, halorhodopsins, and other optogenetic genes enables them to...
Sequencing Primers

Type

Guide

...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...

Showing: 361 - 374 of 374 results

Results per page:

Deep Dive: Statistical Tests (Comparisons)

Plasmids 101: Using Transposons in the Lab

Tips for a 1st Time CRISPR User (by a 1st Time CRISPR User)

Important Considerations When Using AAVs

An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

Plasmids 101: Modular Cloning Applications and Kits

Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

Special Delivery: Fluorophore Targeting for FRET Studies

CRISPR 101: Cytosine Transversion Editors

CRISPR 101: Multiplex Expression of gRNAs

Troubleshooting and Optimizing a Western Blot

Viral Vectors 101: Systemic Capsids

Adeno-associated virus (AAV) Guide

Sequencing Primers

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections