We narrowed to 55 results for: Chia
-
TypeCollection...Szelenyi ER, Trader C, Balaram P, van Velthoven CTJ, Chiang M, Mich JK, Dee N, Goldy J, Cetin AH, Smith K, ...
-
27 Hot Plasmids from 2016
TypeBlog Post...genome-engineering endeavours of unparalleled complexity in Escherichia coli, like the construction of a so-called “genomically... -
Sequencing Primers
TypeGuide...List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'...5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward primer 35S promoter...Forward CAATTTACATCTTTATTTATTAACG (Invitrogen) For Pichia vectors with AUG1 promoter, forward primer AUG1...Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1 promoter, reverse primer BGH ... -
CRISPR Guide
TypeCollection...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine... -
CRISPR Guide
TypeGuide...have been created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine...