We narrowed to 72 results for: retroviral vector

...use viral vectors for many experimental purposes. To help you make sense of all the viral vector information...Subscribe to Viral Vector Blog Posts from Addgene Need more information on viral vectors? Check out our ...our viral vector guide pages, our Lentivirus FAQ, and our viral service pages. Click on the Image Above ... viral vector...some of the most important characteristics of retroviruses, lentiviruses, AAVs, and adenoviruses in this...

...Viral Vectors 101: Viral Applications Adenoviral Vector Production and Troubleshooting Viral Vectors 101...fact, of how adenoviral vectors work. What are adenoviruses?   Adenoviral vectors are commonly derived from...adenoviral vectors all have a genomic capacity that is much higher than other viral vectors (tens of kilobases...has been reported when using vectors, and immune inactivation of the vector can still occur even in the...toolbox for adenoviral vectors in Addgene’s repository is smaller than for other vector types, we hope that... of existing vectors, as well as research into the development of new adenoviral vectors. This post was....7 kb for AAV, 9 kb for retroviruses). The tradeoff is that adenoviral vector expression is very short-lived...

...knock out plasmids? Check out our Cre vector and Murine LoxP vector.   Turn it off for a little while Transient...? Check out our Retro expression vector and Lenti expression vector. Turn it on for just a little while...out Addgene's Lentiviral dCas9 SAM vector and Piggybac dCas9 SAM vector! On/off control all the time If ...Addgene's Lentiviral dTAG cloning vector and SMASh degron tagging vector! Destabilizing domains Destabilizing...Lentiviral Tet-on and AAVS1 targeted Tet-on transgene vector. Degron tags Tagging relevant proteins with a degron...levels. Looking for a DD? Check out our DD-Cas9 vector! The price of tunable control These systems can...integrate your choice cDNA. Both lentivirus and retrovirus can package cDNAs for genomic delivery and have...

... in a single lentiviral transfer vector or separate transfer vectors. May contain reporter gene (e.g. ...Components of System Application Mammalian expression vector Promoter driving Cas9 expression can be constitutive...CRISPR elements are inserted into an AAV transfer vector and used to generate AAV particles. Transient or...easy Very hard Viral delivery   Lentivirus Retrovirus AAV Cells Dividing or nondividing Dividing ...

...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting... interest and cloned into provided destination vectors using low-cost, one-pot golden gate cloning that... Jacks Lab constructed several GMAP-compatible vectors for a wide variety of biological applications. ... problem, Csaba Pál’s lab has created a set of vectors that allows one to use the MAGE method in unmodified...clinically relevant bacterial species. pORTMAGE vectors open new horizons to modify genomes in a broad ...

...and in vitro methods are similar except that the vectors carrying the transdifferentiation factors are directly... (iPSCs) by temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci U S A, 2011. 108(34): p. 14234...., Human induced pluripotent stem cells free of vector and transgene sequences. Science, 2009. 324(5928...mouse induced pluripotent stem cells without viral vectors. Science, 2008. 322(5903): p. 949-53. PubMed PMID...Differentiate the Stem Cell Field Learn how lentiviral vectors can be used for gene delivery Resources on Addgene.org...Addgene.org Visit our Stem Cell Pages Find Viral Vectors for Your Research Find Plasmids from the Yamanaka...Some of the more common delivery methods include retrovirus [2], lentivirus [4], adenovirus [5], Sendai virus...

...purifying recombinant proteins, producing viral vectors, and more. Your protocol might call for adding ...oligos of paired CDR3β-α sequences into TRBV-TRAC vectors to generate TRBV-CDR3β-CDR3α-TRAC. Step 2 inserts... 3 transfers the complete TCRs to an expression vector. TCR libraries are expressed in cells via lentiviral...approach of receptor-antigen pairing by targeted retroviruses (RAPTR) and with peptide-pulsed antigen-presenting...

...Expression (this is a bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression...Mammalian Retroviral Expression mCherry 587 610 16 4.5 15 min Monomer pcDNA3 mCherry LIC cloning vector (6B)...Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo...Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial...pCLIP-tag (m) Vector - Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag... or search our complete collection to filter by vector type, popularity, and more. Blue/UV Protein Excitation...93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Return to top Yellow Protein...

...Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors...Gamma-retroviral vector packaging methods. Viral Vector Integration Much like lentiviral vectors, gamma-retroviral...gamma-retroviral vectors integrate at random locations throughout the genome. Gamma-retroviral vectors tend...Common Uses of Gamma-Retroviral Vectors Due to their integration, gamma-retroviral vectors are useful research... gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors...popular application of gamma-retroviral vectors. Gamma-retroviral vectors have been shown to be safe delivery...Addgene's lentiviral vector guide . Gamma-Retroviral Vectors The genome of gamma-retroviruses ranges from 9–...

...stem cells (ESCs) with a lentiviral vector, an attenuated retrovirus in the same family as HIV. By design...

...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically ranges from...’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Viral Vector Integration... Answered The Retroviral Lifecycle More Viral Vectors 101 topics More Lentiviral Vector topics Addgene...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...

... CRISPRTwenty Years of Sharing: Addgene's Viral Vector Service...Lentiviral Guide AAV Guide Optogenetics Guide γ-Retrovirus Guide Protocols Agarose Gel Electrophoresis...

...inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...

... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells... Mitophagy Dual-emission mitophagy biosensor (retroviral expression of pH sensitive mt-mKeima) The ubiquitin...mitochondria"). ID Plasmid Description Gene/Insert Vector Type Eligible for Viral Packaging PI Return to ...

...engineered into viral vectors for safe use in the lab. One safety feature of lentiviral vectors is that the components...plasmids available at Addgene. Read our Lentiviral Vector Guide for more information about lentiviral components... viral production, and viral safety. Lentiviral Vector Guide Popular Lentiviral Transfer Plasmids Looking...Description PI 1732 pCPRDEnv 2nd Part of the FELIX vector system. Expresses gag-pol and rev . Garry Nolan...Kasparov Return to top Additional Resources Lentiviral Vector Guide Addgene’s Viral Service Lentiviral Pooled...Pooled Libraries All Viral Plasmids Viral Vectors 101 eBook Biosafety Resource Guide Addgene blog: Tips for...Plasmids Resources Lentiviruses, a subset of retroviruses, are some of the most common and useful types...

... open reading frames (ORFs) cloned into a retroviral vector which adds a myristoylation sequence and flag-epitope...CARMA1, MGC133069 CBL Cas-Br-M (murine) ecotropic retroviral transforming sequence C-CBL, CBL2, RNF55 CBLB...CBLB Cas-Br-M (murine) ecotropic retroviral transforming sequence b DKFZp686J10223, DKFZp779A0729, DKFZp779F1443...Nbla00127, RNF56 CBLC Cas-Br-M (murine) ecotropic retroviral transforming sequence c CBL-3, CBL-SL, RNF57 ...Reading Frames (ORFs) in pDONR-223 Gateway® Entry vectors from the labs of William Hahn and David Root . ...systems. The MXS-chaining kit includes chaining vectors with multiple cloning sites and standardized building...

...Proteins Protein Expression Synthetic Biology Viral Vectors Communities Find a scientific community that has...Plasmids Lentivirus Adeno-associated Virus (AAV) γ-Retrovirus Adenovirus All Viral Plasmids Curated Topics ...

...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...usually for the purposes of gene study. Expression vectors must contain a promoter sequence, a transcription... sequence, and the inserted gene. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

...237005 VCP-HaloTag Vector VCP Halo CMV ALS Promega Corporation 237006 HaloTag-VCP Vector VCP Halo CMV ALS...HiBiT-TREM2 Vector TREM2 HiBiT CMV Alzheimer's Promega Corporation 238681 NanoLuc-TREM2 Vector TREM2 NanoLuc...HaloTag-TREM2 Vector TREM2 HaloTag CMV Alzheimer's Promega Corporation 238706 NanoBRET Assay Vector, CSF1R-NanoLuc...PINK1-SmBiT Vector PINK1 SmBiT CMV Parkinson's Promega Corporation 238783 PINK1-LgBiT Vector PINK1 LgBiT...LgBiT-TREM2 Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238801 TREM2-SmBiT Vector TREM2 SmBiT...LgBiT Vector TREM2 LgBiT CMV Alzheimer's Promega Corporation 238850 EIF2AK2-NanoLuc Fusion Vector EIF2AK2...Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 polH GAL...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

...Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies Produced by the immune system, antibodies...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...