Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 73 results for: retroviral vector

Showing: 51 - 73 of 73 results

  1. An Introduction to Adenovirus

    Type
    Blog Post
    ...Viral Vectors 101: Viral Applications Adenoviral Vector Production and Troubleshooting Viral Vectors 101...fact, of how adenoviral vectors work. What are adenoviruses?   Adenoviral vectors are commonly derived from...adenoviral vectors all have a genomic capacity that is much higher than other viral vectors (tens of kilobases...has been reported when using vectors, and immune inactivation of the vector can still occur even in the...toolbox for adenoviral vectors in Addgene’s repository is smaller than for other vector types, we hope that... of existing vectors, as well as research into the development of new adenoviral vectors. This post was....7 kb for AAV, 9 kb for retroviruses). The tradeoff is that adenoviral vector expression is very short-lived...

  2. Plasmids 101: The protein expression toolbox

    Type
    Blog Post
    ...knock out plasmids? Check out our Cre vector and Murine LoxP vector.   Turn it off for a little while Transient...? Check out our Retro expression vector and Lenti expression vector. Turn it on for just a little while...out Addgene's Lentiviral dCas9 SAM vector and Piggybac dCas9 SAM vector! On/off control all the time If ...Addgene's Lentiviral dTAG cloning vector and SMASh degron tagging vector! Destabilizing domains Destabilizing...Lentiviral Tet-on and AAVS1 targeted Tet-on transgene vector. Degron tags Tagging relevant proteins with a degron...levels. Looking for a DD? Check out our DD-Cas9 vector! The price of tunable control These systems can...integrate your choice cDNA. Both lentivirus and retrovirus can package cDNAs for genomic delivery and have...

  3. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector for your...Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These systems...single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one vector, and plasmids...expression vectors for insertion of custom gRNA target sequences. CRISPR... CRISPR Empty gRNA Vectors CRISPR Plasmids...Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit...-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila ...

  4. CRISPR References and Information

    Type
    Collection
    ... gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) ... pooled library amplification 1 vector system: lentiCRISPR v2 2 vector system: lentiCas9-Blast and lentiGuide-Puro...Addgene Church gRNA design and cloning gRNA cloning vector PDF, 118 KB Church gRNA design and cloning for ...human pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles Fly: gRNA and...at Addgene Parrott NEBuilder Assembly of CRISPR vectors using ssDNA oligos p201G Cas9 ; p201B Cas9 ; p201H...

  5. CRISPR 101: Mammalian Expression Systems and Delivery Methods

    Type
    Blog Post
    ... in a single lentiviral transfer vector or separate transfer vectors. May contain reporter gene (e.g. ...Components of System Application Mammalian expression vector Promoter driving Cas9 expression can be constitutive...CRISPR elements are inserted into an AAV transfer vector and used to generate AAV particles. Transient or...easy Very hard Viral delivery   Lentivirus Retrovirus AAV Cells Dividing or nondividing Dividing ...

  6. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting... interest and cloned into provided destination vectors using low-cost, one-pot golden gate cloning that... Jacks Lab constructed several GMAP-compatible vectors for a wide variety of biological applications. ... problem, Csaba Pál’s lab has created a set of vectors that allows one to use the MAGE method in unmodified...clinically relevant bacterial species. pORTMAGE vectors open new horizons to modify genomes in a broad ...

  7. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...and in vitro methods are similar except that the vectors carrying the transdifferentiation factors are directly... (iPSCs) by temperature-sensitive Sendai virus vectors. Proc Natl Acad Sci U S A, 2011. 108(34): p. 14234...., Human induced pluripotent stem cells free of vector and transgene sequences. Science, 2009. 324(5928...mouse induced pluripotent stem cells without viral vectors. Science, 2008. 322(5903): p. 949-53. PubMed PMID...Differentiate the Stem Cell Field Learn how lentiviral vectors can be used for gene delivery Resources on Addgene.org...Addgene.org Visit our Stem Cell Pages Find Viral Vectors for Your Research Find Plasmids from the Yamanaka...Some of the more common delivery methods include retrovirus [2], lentivirus [4], adenovirus [5], Sendai virus...

  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors...Common Uses of Gamma-Retroviral Vectors Due to their integration, gamma-retroviral vectors are useful research... gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors...popular application of gamma-retroviral vectors. Gamma-retroviral vectors have been shown to be safe delivery...Addgene's lentiviral vector guide . Gamma-Retroviral Vectors The genome of gamma-retroviruses ranges from 9–...Read our gamma-retroviral guide to learn about gamma-retroviral components, retroviral production, and... Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For...

  9. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression (this is a bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression...Mammalian Retroviral Expression mCherry 587 610 16 4.5 15 min Monomer pcDNA3 mCherry LIC cloning vector (6B)...93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Jump to Top Yellow Protein...5.7 Monomer (A206K) pcDNA3 mCitrine LIC cloning vector (6C) - Mammalian Expression pCS2+8CmCitrine - Zebrafish...Xenopus/C.elegans/Sea urchin pET mCitrine LIC cloning vector (u-mCitrine) - Bacterial Expression mCitrine-N1...562 49 6.5 2.5 hr Monomer pET mOrange LIC cloning vector (u-mOrange) - Bacterial Expression pCS2+8CmOrange... - Mammalian Expression pCS2+mScarlet-C Cloning Vector - Mammalian Expression mScarlet-I 569 593 57 5.4...

  11. Lentiviral Vector Guide

    Type
    Guide
    ...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically ranges from... Answered The Retroviral Lifecycle More Viral Vectors 101 topics More Lentiviral Vector topics Addgene...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a..., see Addgene’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Created with...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...

  12. Twenty Years of Sharing: Expanding Accessibility

    Type
    Blog Post
    ... CRISPRTwenty Years of Sharing: Addgene's Viral Vector Service...Lentiviral Guide AAV Guide Optogenetics Guide γ-Retrovirus Guide Protocols Agarose Gel Electrophoresis...

  13. Sequencing Primers

    Type
    Guide
    ...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer... Lab) Psi packaging signal, 5' of MCS in pBABE vectors, forward primer pGEX 5' GGGCTGGCAAGCCACGTTTGGTG...

  14. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Douglas Kim , GENIE Project Calcium Bicistronic vector expressing GCaMP6 and mRuby2 for imaging neural... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells... Mitophagy Dual-emission mitophagy biosensor (retroviral expression of pH sensitive mt-mKeima) The ubiquitin...mitochondria"). ID Plasmid Description Gene/Insert Vector Type Eligible for Viral Packaging PI Return to ...

  15. Immunology Research Plasmids and Resources

    Type
    Collection
    ... open reading frames (ORFs) cloned into a retroviral vector which adds a myristoylation sequence and flag-epitope...CARMA1, MGC133069 CBL Cas-Br-M (murine) ecotropic retroviral transforming sequence C-CBL, CBL2, RNF55 CBLB...CBLB Cas-Br-M (murine) ecotropic retroviral transforming sequence b DKFZp686J10223, DKFZp779A0729, DKFZp779F1443...Nbla00127, RNF56 CBLC Cas-Br-M (murine) ecotropic retroviral transforming sequence c CBL-3, CBL-SL, RNF57 ...Reading Frames (ORFs) in pDONR-223 Gateway® Entry vectors from the labs of William Hahn and David Root . ...systems. The MXS-chaining kit includes chaining vectors with multiple cloning sites and standardized building...

  16. Molecular Biology Reference

    Type
    Guide
    ...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription...the transcription process to stop. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

  17. Adenovirus Plasmids

    Type
    Collection
    ...Collection of adenovirus shuttle vectors and strains...Biosafety Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook Adenoviruses are a class of medium-sized...100% efficiency. Unlike lentiviruses or other retroviruses , adenoviruses do not integrate into the host...

  18. Plasmid Collections

    Type
    Collection
    ...Proteins Protein Expression Synthetic Biology Viral Vectors Communities Find a scientific community that has...Plasmids Lentivirus Adeno-associated Virus (AAV) γ-Retrovirus Adenovirus All Viral Plasmids Curated Topics ...

  19. CRISPR Guide

    Type
    Collection
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

  20. Lentivirus Plasmids

    Type
    Collection
    ...Kasparov 1732 pCPRDEnv 2nd Packaging part of the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco... Transfer Plasmids Lentiviruses, a subset of retroviruses, are some of the most common and useful types...

  21. CRISPR Guide

    Type
    Guide
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

  22. Science Guides

    Type
    Guide
    ...Chemogenetics CRISPR Optogenetics Pooled Libraries Viral Vectors Antibodies Produced by the immune system, antibodies...restricted to certain gene sets. Read More Viral Vectors Find educational guides to learn more about the...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...

  23. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Plasmid Type Mammalian, non-viral Lentiviral AAV Retroviral Bacterial Yeast Other Promoter CMV T7 polH GAL...19 James Trimmer 129409 Slc1a3-CreERT2 Targeting Vector SLC1A3 PGK Episodic ataxia Walker Jackson 129410...
Showing: 51 - 73 of 73 results