Skip to main content
Addgene

We narrowed to 109 results for: 1-Oct;

Showing: 21 - 40 of 109 results
  1. Hot Plasmids: FRET-Based Biosensors

    Type
    Blog Post
    ...self-associating fluorescent domains. ACS Chem Biol. 2013 Oct 18;8(10):2133-9. doi: 10.1021/cb400427b. Epub 2013...variants. This resulted in the construction of redCALWY-1, a red-shifted FRET sensor for zinc using variants...
  2. Viral Vectors 101: Biosensors

    Type
    Blog Post
    ...Introduction to Biosensors. Essays Biochem. 2016 Jun 30;60(1):1-8. DOI: 10.1042/EBC20150001 Leopold, A. V., Shcherbakova...Applications. Frontiers in Cellular Neuroscience. 2019 Oct Vol. 13; 1662-5102. DOI: 10.3389/fncel.2019.00474...
  3. Plasmids for Endogenous Gene Tagging in Human Cells

    Type
    Blog Post
    ...Last updated on Oct 14, 2020 by Seth Kasowitz. This post was contributed by the gene editing team at ...Collection Fluorescent tagging strategy Figure 1: Gene editing is the addition of a useful coding sequence...plasmid design strategy. A donor plasmid contains 1 kb homology arms matching the gene of interest, a ...Institute website at alleninstitute.org. References 1. Roberts, Brock, et al. "Systematic gene tagging using...
  4. Plasmids 101: CcdB - The Toxic Key to Efficient Cloning

    Type
    Blog Post
    ... the F plasmid ccdB killer gene”. Gene. 1994 Oct 11;148(1):71-4. PubMed PMID: 7926841. 4. Bernard, P.,...succumb to the toxicity of CcdB.   Figure 1: Image from Bernard, P., et al. showing the pKIL 18...submit a guest blog entry of your own! References 1. Bernard, P. “Positive Selection of Recombinant DNA...
  5. Lentiviral Vector Uses and Overview

    Type
    Blog Post
    ...HIV-1 were transduced with a lentiviral vector containing an antisense sequence against the HIV-1 envelope...U, Takahashi M, Gage FH, Verma IM. J Virol. 1998 Oct;72(10):8150-7. PubMed PMID: 9733856. PubMed Central...Trono and collaborators turned to the lentivirus HIV-1, well-known to infect non-dividing cells. The first...plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due to a few...plasmid encoded the desired transgene flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral... targeting and tracing cells in the brain (Figure 1). 2nd generation lentiviral packaging system The graphic...infectivity, is often used as a substitute for HIV-1 Env, which can only infect CD4+ cells. 3rd generation...
  6. Antibodies 101: Producing Recombinant Antibodies

    Type
    Blog Post
    ...Mechanisms, detection, and control. Int J Pharm. 2018 Oct 25;550(1-2):251-268. doi: 10.1016/j.ijpharm.2018.08.043...materials have been washed away (Figure 1).      Figure 1: The steps of rAb production. Created ...EBNA1 Cells. Methods Mol Biol. 2018;1850:1-16. doi: 10.1007/978-1-4939-8730-6_1. PMID: 30242676. Frenzel...Neuroscience Research. Curr Protoc Neurosci. 2020 Dec;94(1):e106. doi: 10.1002/cpns.106. PMID: 33151027; PMCID...
  7. AAV Titers: Where Do They Come From And What Do They Mean?

    Type
    Blog Post
    ...near-perfect physical-to-infectious particle ratio of 1:1 (Zeltner et al., 2010). However, for recombinant ...preparations are genome-containing (Figure 1).    Figure 1: Electron micrograph of an Addgene AAV...PCR versus analog real-time PCR. Nat Methods. 2013 Oct;10(10):1003-5. PubMed PMID: 22035192. PubMed Central...reported a physical-to-infectious particle ratio of 50:1 (Zeltner et al., 2010). The specific infectivity of... lot (if we still have it available). References 1. Fagone, Paolo, et al. "Systemic errors in quantitative... Human Gene Therapy, Part B: Methods 23.1 (2011): 1-7. PubMed PMID: 22428975. PubMed Central PMCID: PMC3640491...
  8. Overcoming the Challenges of Lentiviral Production

    Type
    Blog Post
    ...limit of lentiviral vectors. Hum Gene Ther. 2001 Oct 10;12(15):1893-905. PubMed PMID: 11589831. Jiang ...is best for larger genes such as Cas9. See figure 1 for an example of how changing transfection ratios...
  9. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ... Rheenen J, Simons BD, Clevers H. Cell. 2010 Oct 1;143(1):134-44. PubMed. Drosophila Brainbow: a recombinase-based...the Brainbow mouse neural labeling system. Brainbow-1 and -2 have been further refined to create Brainbow...subsequent recombinations cannot occur. While the Brainbow-1 system employs Cre-mediated deletion, the design of...antibodies specific to each fluorophore. Third, Brainbow-1 and Brainbow-2 each contained a “default” state; for...dendritic processes not previously visible with Brainbow-1 and -2. The general structure of Brainbow-1.0 is retained...
  10. CRISPR Activation: A Practical Guide

    Type
    Blog Post
    ...Last updated Oct 7, 2020 by Gabrielle Clouse. This post was contributed by guest bloggers Marcelle Tuttle...activity to a transcriptional activation domain (Fig 1). Two ways to use CRISPRa for your research CRISPRa... Stucka R, Hauber J, Lange UC (2016) Targeted HIV-1 Latency Reversal Using CRISPR/Cas9-Derived Transcriptional...
  11. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...transgenesis constructs. Kirchmaier et al., PLOS One 2013 Oct 7;8(10):e76117. Irreversible peptide-peptide ligation...9(5):1104-12. Heinemann et al., FEBS Lett 2012 Oct 19;586(20):3716-22. Park et al., Science 2011 Aug...expression. Brown et al., Genesis 2014 Jan;52(1):39-48. APEX2 for proteomic mapping and electron...engineering cells that lack release factor one (RF-1; Bacterial strain EcAR7) and minimizing the set of... of human mitogen-activated ERK activating kinase 1 (MEK1) with either one or two phosphoserine residues...comprised of three sets of cloning vectors (Level 0, 1, or 2) which can be utilized in three successive assembly... vectors are directionally assembled into a Level 1 vector creating a single transcriptional unit (Ex:...
  12. CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9

    Type
    Blog Post
    ...Originally published Oct 11, 2016 and last updated Dec 22, 2020 by Benoit Giquel. CRISPR has taken the...target cell line or organism (Presented in figure 1). More information on Agrobacterium-mediated transformation...mediated cloning of your gRNA of interest. Figure 1: Simplified schematic of agrobacterium-mediated transformation...
  13. Generating Mouse Models Using CRISPR/Cas9

    Type
    Blog Post
    ...Last updated on Oct 1, 2020 by Aliyah Weinstein. This post was contributed by guest bloggers, Wenning...process check out our Mouse Modeling blog posts: Part 1: Genetically Engineered Mice and Part 2: Breeding ...
  14. Plasmids 101: Modular Cloning Applications and Kits

    Type
    Blog Post
    ... Technologies. Cold Spring Harbor Laboratory, 27 Oct. 2023. Crossref, https://doi.org/10.1016/j.xgen.2024.100519...within the mitochondrial matrix.     Figure 1: A chart with MoClo kit recommendations for different...Traditional Biology.” ACS Synthetic Biology, vol. 5, no. 1, American Chemical Society (ACS), 4 Nov. 2015, pp...., vol. 4, no. 9, American Chemical Society (ACS), 1 May 2015, pp. 975–86. Crossref, https://doi.org/10.1021...Yeast Mitochondria.” BMC Biotechnology, vol. 17, no. 1, Springer Science and Business Media LLC, 13 Nov. ...Editing in Plants.” BMC Plant Biology, vol. 20, no. 1, Springer Science and Business Media LLC, 23 Apr. ...Arabidopsis Mutants.” The Plant Journal, vol. 106, no. 1, Wiley, 25 Mar. 2021, pp. 8–22. Crossref, https://...
  15. Validated gRNA Sequences

    Type
    Collection
    ...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...
  16. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha...
  17. Tetracycline Inducible Expression

    Type
    Collection
    ...and releases tet O, enabling transcription (Figure 1). While TetR and tet O could be a basic tool to control...skip ahead to view highlighted Tet plasmids . Figure 1: Tet-regulated expression systems. Left: natural TetR...although the DNA-binding profile is reversed (Figure 1). However, rtTA can induce stronger expression of ...Transactivator PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral Tet-On vector with blasticidin selection...Mikhail Alexeyev 17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV...TetO-FUW-OSKM Tet-On inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf...-tetO-hOKMS Tet-On inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei...
  18. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Farren Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73547 pEvol-pAzFRS.1.t1 pAzFRS.1.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...7FTrp) Bacterial TAG Thomas Huber 207639 pEVOL-NBK-1 PylRS M. mazei Pyrrolysine Bacterial Cole DeForest...and tyrU gene replaced by GentR) and release factor 1. Expresses archaeal MjTyrRS/tRNA pair instead. For...122650 Mm-PylRS-AF/Pyl-tRNACUA PylRS M. mazei trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang...
  19. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression mEGFP 488 507 34 6 Monomer (A206K) pmEGFP-1 - Mammalian Expression mEGFP-N1 - Mammalian Expression...TurboRFP-pBAD - Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...-pBAD - Bacterial Expression mRFP1 584 607 13 4.5 1 hr Monomer pcDNA3-mRFP - Mammalian Expression pMXs-mRFP1... of Biomedical Optics, Feburary 2005, Vol. 10 No. 1, p. 14003 Chu et al. : Nature Methods, May 2014 Vol...pp. 7913–7923 Hoi et al. : Chemistry & Biology, October 2013, Vol. 20 No. 10, pp.1296-304 Kogure et al....
  20. pCXLE toolkit: Efficient episomal plasmid-based method to reprogram peripheral blood cells to iPSCs

    Type
    Blog Post
    ...are based on the Epstein-Barr Nuclear Antigen-1 (oriP-EBNA-1) system where each vector contains a viral ...replication, OriP and the EBNA-1 sequence that encodes for the DNA binding protein EBNA-1 [7]. These two sequences...extra plasmid, pCXWB-EBNA-1 is used in the reprogramming cocktail. pCXWB-EBNA-1 lacks oriP and is unable...expressing additional EBNA-1 transiently. The transiently expressed EBNA-1 increases protein expression...pCXLE vectors listed below in Table 1 are available at Addgene. Table 1: List of pCXLE episomal plasmids,... pCXLE-hOCT3/4-shp53-F 27077 OCT3/4 and shRNA against p53 pCXWB-EBNA1 37624 transient EBNA-1   Many...expression of the reprogramming factors- OCT3/4, SOX2, KLF4, and C-MYC [1]. For the derivation of clinical grade...
Showing: 21 - 40 of 109 results