We narrowed to 27 results for: 1-Oct;
-
TypeCollection...marking active neuron populations. Nat Commun. 2018 Oct 25;9(1):4440. Eric Schreiter Calcium AAV expression ...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...interneurons across vertebrate species. Nat Neurosci. 2016 Oct 31. Gordon Fishell Calcium GCaMP5 genetically encoded...indicator for neural activity imaging. J Neurosci. 2012 Oct 3;32(40):13819-40. Baljit Khakh , Douglas Kim , Loren...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET... Secretion of Pancreatic Islets. Anal Chem. 2019 Oct 1;91(19):12212-12219. Huiwang Ai Zinc GZnP2 Cytosolic... Encoded Fluorescent Biosensor. Cell Metab. 2011 Oct 5;14(4):545-54. Gary Yellen NADH/NAD+ Peredox fluorescent...
-
p53 Pathway
TypeCollection...-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific angiogenesis inhibitor 1 Bax BCL2-associated...inhibitor type 1), member 1 PERP TP53 apoptosis effector PIDD p53-induced death domain protein 1 PIGs Etoposide... Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine kinase...kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2...receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell surface death receptor ...SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2...p53 field. Brosh R, Rotter V. Nat Rev Cancer. 2009 Oct;9(10):701-13. PubMed PMID: 19693097 . The expanding... -
Zhang Lab CRISPR Page
TypeCollection...Heidenreich 1, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6....2013.08.021. Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using...2281-308. doi: 10.1038/nprot.2013.143. Epub 2013 Oct 24. PubMed . Return to SpCas9 plasmids GeCKO Library...-6. doi: 10.1038/nbt.3055. Epub 2014 Oct 19. PubMed . In vivo genome editing using Staphylococcus aureus... Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016/j.cell.2014.09.014....SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase) + single guide ...screens. The libraries are available in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Other citations include...Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495. PMID: 27759036 Rosario, et al. 2016. ...for any application TMN200 (200 mM sodium chloride, 1 mM magnesium chloride, 20 mM Tris at pH 8.0) Suitable...adeno-associated viral vector. Hum Gene Ther Methods . Feb;25(1):72-82. PMID: 24191859 Ye, et al. 2015. Safety and... -
Neurodegeneration Research Collection
TypeCollection...between Rab12 and LRRK2 . Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries...target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. Target neural oxytocin receptors using an AAV-CRISPR...dopaminergic activity in vivo. Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation...one of three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of... -
Antibody Plasmid Collection
TypeCollection...Tomlinson I+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox...phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas Vector system for expression...immunostaining. Biochem Biophys Res Commun. 2015 Jan 2;456(1):527-33. Gavin Wright pET-30-based vector dedicated... -
Plasmids for Stem Cell Research
TypeCollection... 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human Sox2, Nanog, Oct4, and Lin28 from...106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible lentiviral expression of mouse Oct4, Sox2...Developmental Potential of iPSCs. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. Schöler You can also...MicroRNA-Dependent Direct Conversion of Fibroblasts. Neuron. 2014 Oct 22;84(2):311-23. Yoo Fibroblasts Neurons Lentiviral...cell reprogramming. Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating...transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory Neurons Lentiviral...peripheral sensory neurons. Nat Neurosci. 2015 Jan;18(1):25-35. Baldwin Fibroblasts iTSCs Lentiviral Mouse... -
Validated gRNA Sequences
TypeCollection...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes... -
Immunology Research Plasmids and Resources
TypeCollection...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...endogenous repair mechanisms. Cas3 belongs to the Class 1 family of CRISPR systems, the most abundant type found...bacteria and archaea. While abundant in nature, Class 1 systems are largely underutilized compared to their...still separate the individual Cas components. Figure 1: Overview of Cascade-Cas3 mechanism. Created with ...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
Tetracycline Inducible Expression
TypeCollection...and releases tet O, enabling transcription (Figure 1). While TetR and tet O could be a basic tool to control...skip ahead to view highlighted Tet plasmids . Figure 1: Tet-regulated expression systems. Left: natural TetR...although the DNA-binding profile is reversed (Figure 1). However, rtTA can induce stronger expression of ...Transactivator PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral Tet-On vector with blasticidin selection...Mikhail Alexeyev 17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV...TetO-FUW-OSKM Tet-On inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf...-tetO-hOKMS Tet-On inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei... -
Lentivirus Plasmids
TypeCollection... . ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puromycin...for hygromycin selection. Bob Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid...coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...Your Lentiviral Preps Content last reviewed: 23 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - Repress Gene Expression
TypeCollection..., or the beginning of the coding sequence. Figure 1: Overview of CRISPR interference. Browse, sort, or...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - RNA Editing
TypeCollection...small enough to be packaged in AAV particles. Figure 1: Overview of RNA targeting with CRISPR. Browse, sort...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - Epigenetics
TypeCollection...also indirectly modify local chromatin state. Figure 1: Overview of epigenetic modification using CRISPR....CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection...the dCas9-activator to your specific locus. Figure 1: Overview of CRISPR activation. Created with BioRender.com...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - Single-Strand Break (Nick)
TypeCollection... edits via homology-directed repair (HDR). Figure 1: Overview of Cas9 nickase cleavage and repair. Browse...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - RNA Targeting
TypeCollection...collateral RNA degradation seen in bacteria. Figure 1: Overview of RNA targeting. Browse, sort, or search...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - Purify Genomic Loci
TypeCollection...with a genomic region of interest in vivo. Figure 1: Overview of purification of genomic loci using CRISPR...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...with target sites throughout the chromosome. Figure 1: Overview of visualizing genomic loci using CRISPR...CRISPR Blogs CasPEDIA Content last reviewed: 17 October 2025 Do you have suggestions for other plasmids...