Skip to main content
Addgene
Showing: 21 - 40 of 77 results
  1. R Bodies: Membrane-Rupturing Microscopic Tools

    Type
    Blog Post
    ...were first expressed in E. coli in the 1980s  (Kanabrocki et al 1986). Much later, it was shown that putting...her on Twitter @jessicapolka.     References 1. Kanabrocki, J. A., Quackenbush, R. L. & Pond, F. R. Organization...
  2. Early Career Researcher Toolbox: Social Media for Scientists

    Type
    Blog Post
    ... with Dr. Stephani Page, the founder of the #BLACKandSTEM Twitter community. Dr. Page shares her story...@ThePurplePage and @HelloPhD "Role" call. #BLACKandSTEM what do you do? — Stephani Page, PhD 👩🏾‍🔬...
  3. CRISPR-mediated Plant Base Editors

    Type
    Blog Post
    ...PMID: 30272679. 8. Hua, Kai, Xiaoping Tao, and Jian‐Kang Zhu. "Expanding the base editing scope in rice by...11.4 (2018): 627-630. PubMed PMID: 29476916. 10. Kang, Beum-Chang, et al. "Precision genome engineering...
  4. Quick Guide to Near-Infrared Fluorescent Proteins

    Type
    Blog Post
    ...contrast than previously developed NIR split probes (Tchekanda et al., 2014, Filonov et al., 2013). FRET biosensors...fluorescent nanobodies. Nat Methods submitted (2021). Tchekanda, E., Sivanesan, D. & Michnick, S.W. An infrared...
  5. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...acid to Drosophila cells. Work by Wei et al. from Kang Shen’s lab has also shown that the Q system is also.... Wei, Xing, Christopher J. Potter, Liqin Luo & Kang Shen. “Controlling gene expression with the Q repressible...
  6. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ... the B. subtilis Single Gene Deletion Library—Kanamycin and the CRISPRi Essential gene Knockdown library...regions (excluding start and stop codons) with kanamycin cassettes and were carefully designed to allow...
  7. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ... 2013), and are available with URA3, SpHIS5 and KANMX markers. The FP together with the protothropic cassette...) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid Gene/Insert Selectable Marker...
  8. Pouring LB Agar Plates

    Type
    Protocol
    ...in DMSO) 25 µg/mL Gentamycin 10 mg/mL 10 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...
  9. CRISPR Plasmids - Tagging

    Type
    Collection
    ... CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato Kanemaki's lab has developed a ...
  10. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Cas9-based AID tagging Seven years ago, Masato Kanemaki's lab successfully used the plant-based auxin-inducible...described in their recent Cell Reports paper, the Kanemaki lab overcame this hurdle using CRISPR technology...
  11. Validated gRNA Sequences

    Type
    Collection
    ...TATTAAATGCAGATAACCT 66089 cut S. pyogenes 25249454 Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes...GGGGCCACTAGGGACAGGAT 72833 cut S. pyogenes 27052166 Kanemaki mmp21 D. rerio CGGAGCTGATCACTGACA 72890 cut S....
  12. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...contains a nonfunctional truncated version of the kanamycin resistance gene (missing the first two codons)...pUCXKT will therefore have resistance to both kanamycin and ampicillin (from the pUC19 backbone). *False...
Showing: 21 - 40 of 77 results