Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 61 results for: RFP

Showing: 21 - 40 of 61 results

  2. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...) a RFP protein that binds to the 3’ UTR of the reporter mRNA via an MS2 coat protein (NLS-MS2-RFP) the...transcribed, it is bound by both the GFP and the RFP proteins in the nucleus. During the first round of...nucleus (thanks to a NLS on these proteins). The RFP proteins, however, remain bound to the mRNA since...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2...vector expressing a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create...

  8. Cre-lox system

    Type
    Collection
    ... CREM CMV Mammalian Green 8401 p224 pCMV-RFP/CREM floxed RFP within CREM CMV Mammalian Green 8403 p153...GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch plasmid Mammalian Green 22799...hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible reporter with Cre dependent H2B-RFP expression Zebrafish Stainier 51269 pCAG-loxPSTOPloxP-ZsGreen...and Cre CAG Mammalian Zhang 68477 pTRE:iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks...Cre None Zebrafish Stankunas 82696 pCRE-iRFP670 Cre and iRFP670 PGK Mammalian Mullen 84032 pHD066 mCherry-Cre...CAG Mammalian Stringer 68448 TOPO rtTA3-2A-Cre iRFP670, Cre, and GFP EFS Lentiviral Jacks 68468 Cas9-2A-Cre...

  9. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...LSSmOrange mRuby2 Red Mammalian Expresses mRuby2 (a RFP variant) commonly used with Clover pGWF1 Cyan & Yellow...

  10. Lentivirus Plasmids

    Type
    Collection
    ...Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter...

  11. Tetracycline Inducible Expression

    Type
    Collection
    ...sgRNA TetR H1-2O2 Nathanael Gray 35625 pAAV-Ptet-RFP-shR-rtTA AAV Tet-On shRNA vector. To evaluate shRNA... Karpf 167935 pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G Tet-inducible expression of KRAB-dCas9...

  12. Validated gRNA Sequences

    Type
    Collection
    ...ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes 26829286 Lu rfp AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes...

  13. Quick Guide to Near-Infrared Fluorescent Proteins

    Type
    Blog Post
    ...Enhanced miRFPs are monomeric and bright Recent series of enhanced monomeric NIR FPs named miRFPs (monomeric...Therefore, we recommend using miRFPs and their enhanced versions named emiRFPs in your applications.  There...set of spectrally distinct (e)miRFPs available. The numbers in (e)miRFP names correspond to the maxima...multicolor NIR imaging.  Small miRFPnano A separate class of NIR FPs, named miRFPnanos, were derived from cyanobacteriochrome...advantages are their small size (17 kDa for miRFPnanos, 35 kDa for miRFPs, and 27 kDa for EGFP) and a possibility... of the N- and C-termini. Latest miRFPnanos9 do not yield to (m)iRFPs in cellular and molecular brightness.... FRET biosensors were developed based on miRFP760-miRFP720 FRET pair, including Rac1 biosensor (Shcherbakova...

  14. In Living Color: The Skinny on In Vivo Imaging Tools

    Type
    Blog Post
    ...phytochome-derived proteins, iRFP670, iRFP682, iRFP702, iRFP713 and iRFP720, is that they absorb and emit...near-infrared fluorescent proteins (FPs), called PAiRFP1 and PAiRFP2, to the in vivo imaging toolbox, which increase...application of near-infrared fluorescent proteins, iRFP670 and iRFP720, as photoacoustic contrast agents for two-color...that near-infrared range, and that’s exactly what iRFPs achieved. Those proteins allowed a signal-to-background...

  18. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ... containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP) tags,...NanoLuc), fluorescent proteins (TagGFP2, TagBFP, TagRFP, and T2A-TurboGFP-PEST), and small epitope tags...

  19. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ...can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours. Temperature: FPs maturation...is set as 1. Some proteins are very dim (e.g. TagRFP657, which has a brightness of 0.1) and this should...
Showing: 21 - 40 of 61 results