Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 60 results for: RFP

Showing: 21 - 40 of 60 results

  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Walther Mothes 1817 Lamp1-RFP Lysosomes Lamp1 RFP Walther Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling... paxillin GFP Rick Horwitz 26720 RFP-zyxin Focal Adhesions Zyxin RFP Anna Huttenlocher 11908 pEGFP-N1 ...AcGFP Gia Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc...Filaments LifeAct miRFP703 Vladislav Verkhusha 79994 pEB3-miRFP703 Microtubules EB3 miRFP703 Vladislav Verkhusha...GFP Pantelis Tsoulfas 80000 pMito-miRFP703 Mitochondria COX8A miRFP703 Vladislav Verkhusha 36208 pmTurquoise2...H2A mScarlet Dorus Gadella 18982 pHIV-H2BmRFP Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2...

  2. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...) a RFP protein that binds to the 3’ UTR of the reporter mRNA via an MS2 coat protein (NLS-MS2-RFP) the...transcribed, it is bound by both the GFP and the RFP proteins in the nucleus. During the first round of...nucleus (thanks to a NLS on these proteins). The RFP proteins, however, remain bound to the mRNA since...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2...vector expressing a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create...

  8. Lentivirus Plasmids

    Type
    Collection
    ...Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter...

  9. Tetracycline Inducible Expression

    Type
    Collection
    ...sgRNA TetR H1-2O2 Nathanael Gray 35625 pAAV-Ptet-RFP-shR-rtTA AAV Tet-On shRNA vector. To evaluate shRNA... Karpf 167935 pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G Tet-inducible expression of KRAB-dCas9...

  10. Validated gRNA Sequences

    Type
    Collection
    ...ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes 26829286 Lu rfp AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes...

  11. Quick Guide to Near-Infrared Fluorescent Proteins

    Type
    Blog Post
    ...Enhanced miRFPs are monomeric and bright Recent series of enhanced monomeric NIR FPs named miRFPs (monomeric...Therefore, we recommend using miRFPs and their enhanced versions named emiRFPs in your applications.  There...set of spectrally distinct (e)miRFPs available. The numbers in (e)miRFP names correspond to the maxima...multicolor NIR imaging.  Small miRFPnano A separate class of NIR FPs, named miRFPnanos, were derived from cyanobacteriochrome...advantages are their small size (17 kDa for miRFPnanos, 35 kDa for miRFPs, and 27 kDa for EGFP) and a possibility... of the N- and C-termini. Latest miRFPnanos9 do not yield to (m)iRFPs in cellular and molecular brightness.... FRET biosensors were developed based on miRFP760-miRFP720 FRET pair, including Rac1 biosensor (Shcherbakova...

  12. In Living Color: The Skinny on In Vivo Imaging Tools

    Type
    Blog Post
    ...phytochome-derived proteins, iRFP670, iRFP682, iRFP702, iRFP713 and iRFP720, is that they absorb and emit...near-infrared fluorescent proteins (FPs), called PAiRFP1 and PAiRFP2, to the in vivo imaging toolbox, which increase...application of near-infrared fluorescent proteins, iRFP670 and iRFP720, as photoacoustic contrast agents for two-color...that near-infrared range, and that’s exactly what iRFPs achieved. Those proteins allowed a signal-to-background...

  16. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ... containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP) tags,...NanoLuc), fluorescent proteins (TagGFP2, TagBFP, TagRFP, and T2A-TurboGFP-PEST), and small epitope tags...

  17. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ...can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours. Temperature: FPs maturation...is set as 1. Some proteins are very dim (e.g. TagRFP657, which has a brightness of 0.1) and this should...

  19. New Viral Vectors - Spring 2025

    Type
    Blog Post
    ...Serotype Category Depositor  Notes pAAV-CAG-emiRFP670 AAV1 Control Kiryl Piatkevich New viral tool ...

  20. Hot Plasmids - February 2022

    Type
    Blog Post
    ...anti-FLAG frankebodies includes mEGFP, mRuby2, iRFP713, SNAP-tag, and HaloTag fusions, while the anti-...
Showing: 21 - 40 of 60 results