We narrowed to 20 results for: RFP
-
TypeCollection...Walther Mothes 1817 Lamp1-RFP Lysosomes Lamp1 RFP Walther Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling... paxillin GFP Rick Horwitz 26720 RFP-zyxin Focal Adhesions Zyxin RFP Anna Huttenlocher 11908 pEGFP-N1 ...AcGFP Gia Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc...Filaments LifeAct miRFP703 Vladislav Verkhusha 79994 pEB3-miRFP703 Microtubules EB3 miRFP703 Vladislav Verkhusha...GFP Pantelis Tsoulfas 80000 pMito-miRFP703 Mitochondria COX8A miRFP703 Vladislav Verkhusha 36208 pmTurquoise2...H2A mScarlet Dorus Gadella 18982 pHIV-H2BmRFP Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2...
-
Bikard Lab - CRISPR Repression Collection
TypeCollection...tracrRNA sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting... -
Lentivirus Plasmids
TypeCollection...Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter... -
Tetracycline Inducible Expression
TypeCollection...sgRNA TetR H1-2O2 Nathanael Gray 35625 pAAV-Ptet-RFP-shR-rtTA AAV Tet-On shRNA vector. To evaluate shRNA... Karpf 167935 pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G Tet-inducible expression of KRAB-dCas9... -
Validated gRNA Sequences
TypeCollection...ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes 26829286 Lu rfp AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes... -
Fluorescent Protein Guide: Biosensors
TypeCollection...flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an Internal...Mizushima Autophagy Autophagosome maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation ... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Expression iRFP (aka iRFP713) 690 713 6 4.5 2.8 h Dimer piRFP - Mammalian Expression pBAD/His-B-iRFP - Bacterial...Mammalian Expression mCyRFP1 528 594 18 5.6 Monomer pNCS-mCyRFP1 - Bacterial Expression mCyRFP1-C1 - Mammalian... Expression mRFP1 584 607 13 4.5 1 h Monomer pcDNA3-mRFP - Mammalian Expression pMXs-mRFP1 - Mammalian...Expression pTagRFP657-C1 - Mammalian Expression pFA6a-link-yoTagRFP657-Kan - Yeast Expression smURFP 642 670...Structure Plasmids emiRFP670 642 670 12 4.5 Monomer pemiRFP670-N1 - Mammalian Expression miRFP670 642 670 12 ...Expression pBAD/His-miRFP670 - Bacterial Expression iRFP670 643 670 13 4 ~5 h Dimer piRFP670-N1 - Mammalian...pBAD/HisB-iRFP670 - Bacterial Expression miRFP670nano3 645 670 24 4.2 Monomer pcDNA-miRFP670nano3 - Mammalian... -
Fluorescent Protein Guide: In Vivo Imaging
TypeCollection... piRFP682-N1 iRFP702 673/702 7.6 piRFP702-N1 miRFP703 673/703 8 pmiRFP703-N1 miRFP709 683/709 4 pmiRFP709...Brightness Plasmids iRFP670 643/670 12.7 piRFP670-N1 miRFP670 642/670 12 pmiRFP670-N1 iRFP682 663/682 10.2 piRFP682...pmiRFP709-N1 iRFP (aka iRFP713) 690/713 6.2 piRFP iRFP720 702/720 5.8 piRFP720-N1 iSplit 690/713 5.3 pPAS-...Brightness Plasmids PAiRFP1 690/717 (after photoactivation) 3.2 pPAiRFP1-N1 PAiRFP2 692/719 (after photoactivation...photoreceptors (BphPs). Spectrally distinct fluorescent iRFP variants have been shown to have high brightness...single or multicolor imaging. Photo-activatable iRFPs can be turned on by non-phototoxic far-red light...living animals. Further development of the original iRFP has resulted in a split fluorescence complementation... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of K-Ras Plasma Membrane 114403 LMNB1-mTagRFP-T AICSDP...AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP...protein PMP34 Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1...Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP-69 mTagRFP-T Nucleophosmin Nucleolus (granular component...AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405... -
Neurodegeneration Plasmid Collection
TypeCollection...Parkinson's Christien Merrifield 27700 Hip1R-tDimerRFP-N1 Hip1R RFP CMV Parkinson's Christien Merrifield 28195...Lazarou 119693 pBMN iRFP670-OPTN(D474N) OPTN iRFP670 ALS Michael Lazarou 119694 pBMN iRFP670-OPTN(F178A/D474N...Clifford Brangwynne 122441 pHR-FUSN-miRFP670-Cry2WT FUS Cry2WT, miRFP670 SFFV ALS Clifford Brangwynne 122668...Huntington's Paul Herman 226380 pcDNA3.1(-).TagRFP.T-2A-Tau2N4R-WPRE MAPT TagRFP, T2A CMV, T7 Parkinson's, FTD Bradley...Bradley Hyman 226381 pcDNA3.1(-).TagRFP.T-2A-V5-Tau2N4R-WPRE MAPT TagRFP, T2A, V5 CMV, T7 Parkinson's, FTD...Bradley Hyman 226382 pcDNA3.1(-).TagRFP.T-2A-V5-8D2Q.Tau2N4R-WPRE MAPT TagRFP, T2A, V5 CMV, T7 Parkinson's...Bradley Hyman 226383 pcDNA3.1(-).TagRFP.T-2A-V5-20D3Q.Tau2N4R-WPRE MAPT TagRFP, T2A, V5 CMV, T7 Parkinson's... -
Penn Vector Core Partnership with Addgene
TypeCollection....CB7.CI.TurboRFP.WPRE.RBG James M. Wilson AV-9-PV2177 105548-AAV9 pENN.AAV.CMVs.TurboRFP.WPRE.RBG James... M. Wilson AV-1-PV2177 105548-AAV1 pENN.AAV.CMVs.TurboRFP.WPRE.RBG Control James M. Wilson AV-1-PV2642...PV2642 105552-AAV1 pENN.AAV.hSyn.TurboRFP.WPRE.RBG Control James M. Wilson AV-1-PV2975 105622-AAV1 pAAV.CamKII... M. Wilson AV-5-PV2177 105548-AAV5 pENN.AAV.CMVs.TurboRFP.WPRE.RBG Control James M. Wilson AV-5-PV2213... M. Wilson AV-8-PV2177 105548-AAV8 pENN.AAV.CMVs.TurboRFP.WPRE.RBG Control James M. Wilson AV-9-27056 ... M. Wilson AV-5-PV2642 105552-AAV5 pENN.AAV.hSyn.TurboRFP.WPRE.RBG James M. Wilson AV-5-PV2820 100838-... M. Wilson AV-9-PV2642 105552-AAV9 pENN.AAV.hSyn.TurboRFP.WPRE.RBG James M. Wilson AV-9-PV3080 100840-... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Puro Wolfe pL-CRISPR.EFS.tRFP 57819 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes tagRFP Ebert pFGC-pcoCas9...Wolfe pLKO5.sgRNA.EFS.tRFP657 57824 Mammalian/Lentiviral BsmBI none S. pyogenes tagRFP657 Ebert pL-CRISPR.SFFV.GFP...EGFP Ebert pLKO5.sgRNA.EFS.tRFP 57823 Mammalian/Lentiviral BsmBI none S. pyogenes tagRFP Ebert pL-CRISPR.SFFV.tRFP...Mammalian/Lentiviral BsmBI yes, cut S. pyogenes tagRFP Ebert pSAG1::CAS9-U6::sgUPRT 54467 Other/Toxoplasma... -
Control AAV Preps
TypeCollection...PHP.eB James M. Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 James M. Wilson...Constitutive 5 James M. Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG hSyn TurboRFP Constitutive 1 James M. Wilson...9, PHP.eB Guoping Feng 197200 pAAV-CAG-emiRFP670 CAG emiRFP670 Constitutive 1 Kiryl Piatkevich 214147 ... -
Bacterial Expression Systems
TypeCollection...134405 pBbAW4k-loxP-TT-loxP-mRFP1 Cre recombinase activity Fluorescence (mRFP1) Escherichia coli Mary Dunlop...reconstructed) BiFC Dan Mulvihill 39866 pWA PAS-E BAD K-GAFm iRFP (reconstructed) BiFC Vladislav Verkhusha 52732 52733...Promoter activity GUS activity and fluorescence (mRFP1) Gram-negative bacteria Philip Poole 14473 pRU1156...Poole 14471 pRU1144 Promoter activity Fluorescence (mRFP1) Gram-negative bacteria Philip Poole 14462 pRU1097...Vogel 46002 pGR Terminator strength Fluorescence (GFP:mRFP1 ratio) Escherichia coli Christopher Voigt 65008... -
Fluorescent Proteins: FRET
TypeCollection... mCherry2-N1 miRFP670 miRFP720 642 0.14 720 87,400 0.061 5.7 13 pmiRFP670-N1 , pmiRFP720-N1 LSSmOrange... -
CRISPR Plasmids - Prime Edit
TypeCollection...epegRNA BsaI No mRFP1 David Liu 174039 pU6-tmpknot-GG-acceptor Mammalian hU6 epegRNA BsaI No mRFP1 David Liu...pegRNA-GG-acceptor Mammalian hU6 pegRNA BsaI No mRFP1 David Liu 140448 QPM-sgR (pTaU3) Plant TaU3 nicking... -
Luciferase Plasmid Collection
TypeCollection...104587 pHIV-iRFP720-E2A-Luc Firefly EF1α Lentiviral expression of firefly luciferase and iRFP720 from a bicistronic... -
Adenovirus Plasmids
TypeCollection...Zhang 50957 RedTrackCMV Shuttle For production of mRFP-trackable viruses containing transgene under CMV... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...mCherry tagged fusion proteins in worms ins:MCS; cryaa:RFP - A zebrafish insulin promoter vector with multiple... -
Immunology Research Plasmids and Resources
TypeCollection...pleiotrophin HARP, HBGF8, HBNF, NEGF1 PYY peptide YY PYY1 QRFP pyroglutamylated RFamide peptide 26RFa, MGC119794...