Skip to main content

We narrowed to 32 results for: TDT

Showing: 21 - 32 of 32 results
  1. Sequencing Primers

    Type
    Guide
    ...promoter Forward tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato Forward tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato Reverse Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene...
  2. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 Cre is coexpressed with tdTomato and Pac (puromycin N-acethyl-transferase... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...
  3. Control AAV Preps

    Type
    Collection
    ... Edward Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Baljit Khakh 50465 pAAV-hSyn-EGFP...PHP.eB Bryan Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Hongkui Zeng 58909 pAAV-GFAP104...Constitutive 5 Edward Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,... rg* Loren Looger 116870 pAAV-CAG-H2B tdTomato CAG H2B-tdTomato Constitutive rg* Loren Looger 105530 pAAV.CMV.PI.EGFP.WPRE.bGH...Maarten Kole 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Guoping Feng... 9, rg* Karl Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...Constitutive 2 Edward Boyden 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Patricia Jensen 99133 pAAV-CAG-fDIO-mNeonGreen...
  4. Caltech Systemic Capsids

    Type
    Collection
    ...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...Dimidschstein 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Control Feng 163505 CN1390-rAAV-DLX2.0...
  5. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian...- Bacterial Expression tdTomato 554 581 95 4.7 1 h Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Return to top Red Protein Excitation (nm) Emission...
  6. Bacterial Expression Systems

    Type
    Collection
    ...18084 54856 pBad-mAmetrine1.1 tdTomato-pBAD mAmetrine1.1 (donor) tdTomato (acceptor) FRET/Dual FRET Robert... 54571 54856 mT-Sapphire-pBAD tdTomato-pBAD mT-Sapphire (donor) tdTomato (acceptor) FRET Robert Campbell...Parish 24657 pASTA3 Promoter activity Fluorescence (tdTomato) Mycobacterium sp. Tanya Parish 24658 pCHARGE3...
  7. AAV Molecular Tools

    Type
    Collection
    ... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals.... Liqun Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent expression...Na+ channel mNaChBac and (physically separate) tdTomato. 8 Massimo Scanziani 34910 paavCAG-pre-mGRASP-...
  8. Fluorescent Proteins: FRET

    Type
    Collection
    ..._C1 mT-Sapphire* tdTomato 399 0.6 581 138,000 0.69 6.4 5.9 mT-Sapphire-N1 , tdTomato-N1 CyOFP1* mCardinal...mCardinal-N1 mAmetrine* tdTomato 406 0.58 581 138,000 0.69 6.5 7.1 mAmetrine-N1 , tdTomato-N1 mTurquoise2 sREACh...
  9. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Harrison 37351 pQC membrane TdTomato IX Membranes Palmitoylation tdTomato Connie Cepko 22479 FUmGW Membranes...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma membrane CARMIL2 BH domain tdTomato John Cooper 189771 pLCK-mScarlet3...
  10. Rett Syndrome

    Type
    Collection
    ...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell...
  11. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...'s Ophir Shalem 215721 pDual-IN-SMN1 SMN1 GFP, tdTomato CAG Spinal muscular atrophy Chaolin Zhang 216225...
  12. Recombinases AAV Preps

    Type
    Collection
    ... none 1 Connie Cepko 69916 pAAV.cTNT.iCre cTnT tdTomato 9 William Pu 203842 pAAV-Ef1a-fDIO-eGFP-2A-Cre-WPRE...
Showing: 21 - 32 of 32 results