Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 133 results for: Tet-on

Showing: 21 - 40 of 133 results

  3. Hot Plasmids - November 2023

    Type
    Blog Post
    ...induced GFP-iPAK4 expressed under promoters like the tet-responsive element (TRE) or the cFos promoter. For...Importantly, even commercial antibodies can be tethered on the viral surface, expanding the range of targetable...

  4. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ... several tetracycline operators. Transcription can be turned on or off depending on what tet transactivator...General expression mRNA Tetracycline response element promoter Inducible with Tetracyline or its derivatives...

  5. Plasmid Collections

    Type
    Collection
    ...Microbiology Plant Expression Stem Cells Synthetic Biology Tet Inducible Expression Worm Expression Kits Kits are...

  6. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ...strain expressing two reporters and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment...allows for quick integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed...

  7. Mammalian RNAi Tools

    Type
    Collection
    ...that allow for conditional (Cre-lox) or inducible (Tet) expression are available. To find plasmids containing...

  8. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...incorporating a Tet-Off system to boost XFP expression. The increased brightness of Tetbow allows this system... proliferating cells. Tetbow optimizes Brainbow for current technologies Tetbow (Sakaguchi et al., 2018...fluorophores RFP (red), YFP (yellow), and membrane-tethered CFP (cyan). Brainbow 1.1 adds OFP (orange) (Livet...Flp recombinase. The XFPs in Flybow are membrane-tethered, making this system useful for visualization of...discriminating neurons within only one field of view. Tetbow can be introduced in vivo either by electroporation...vectors. The Imai lab also developed a version of Tetbow that incorporates chemical tags instead of XFP ...this blog post from the researchers who developed Tetbow. Conclusion Stochastic multicolor cell labeling...

  9. Retrovirus Plasmids

    Type
    Collection
    ...retroviral plasmid Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA; expresses rtTA. See...resistance. Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in...

  10. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...created constitutive (pCMV-dCas9-D3A) and Tet-dependent (TetO-dCas9-D3A) constructs. For lentiviral expression...Researchers showed that TALE-TET1 constructs, which fused a TALEN to the Tet1 demethylase catalytic domain...with BioRender.com. Tet1 demethylase Ronggui Hu’s lab has created pdCas9-Tet1-CD for targeted cytosine...mammalian cells. This plasmid is used with pcDNA3.1-MS2-Tet1-CD to decrease methylation and activate transcription...lentiviral vector with the same modifier, Fuw-dCas9-Tet1CD, is available from Rudolf Jaenisch’s lab in plasmid... ready-to-use lentivirus. Figure 2: dCas9-Tet1 demethylates cytosines at promoters and enhancers...increased transcription. Created with BioRender.com. Tet1 initiates cytosine demethylation of DNA. However...

  11. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids...

  13. Validated gRNA Sequences

    Type
    Collection
    ...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...

  14. Plan Your Experiment

    Type
    Collection
    ... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...

  15. Sequencing Primers

    Type
    Guide
    ... tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer...forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI, forward primer pBRforEco... primer pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI, reverse primer pCAG-...GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward...

  16. Plan Your Experiment

    Type
    Guide
    ... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...

  17. Brain Initiative Collection

    Type
    Collection
    ...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...

  18. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ...pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis eSpCas9(1.1) 71814...

  19. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...inserting OsTIR1 into the "safe harbor" AAVS1 locus (a tet-inducible OsTIR1 plasmid is also available). Second...unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many of which ...subunits of the paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive...

  20. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...gene expression studies, which are evinced by the Tet system and visualization of single molecules via ...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and an inducible...however, remain bound to the mRNA since they are tethered AFTER the stop codon. Thus a non-translated mRNA...MS2 bacteriophage coat protein binding sites to tether many copies of the FP-coat protein fusions to their...
Showing: 21 - 40 of 133 results