We narrowed to 67 results for: cmv
-
TypeCollection...luciferase Eric Campeau 21474 pLenti CMV V5-LUC Blast (w567-1) Firefly CMV Lentiviral expression of firefly...Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai 87121 pcDNA-RLuc8 Renilla CMV Mammalian... luciferase Ming-Chih Lai 100984 pGL4.18 CMV-Luc Firefly CMV Mammalian expression of firefly luciferase... Cypridina EF1α, CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina luciferase...William Hahn, David Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase...firefly luciferase Mark Kay 105532 pAAV.CMV.ffLuciferase.SV40 Firefly CMV AAV expression of firefly luciferase...Venus-firefly luciferase Roland Friedel 170575 pCMV-FLuc Firefly CMV Retroviral expression of firefly luciferase...
-
Introducing Addgene's New Search - Find Plasmids More Easily For Your Research!
TypeBlog Post... plasmid to express ubiquitin under control of a CMV promoter. Starting with two search terms we see there... -
CRISPR 101: Ribonucleoprotein (RNP) Delivery
TypeBlog Post...cells where common eukaryotic promoters (such as CMV or EF1A promoters found in many CRISPR plasmids) ... -
Your Lentiviral Plasmid FAQs Answered
TypeBlog Post...transfer plasmids have a chimeric 5'LTR that includes a CMV or RSV promoter as well as a portion of the 5'LTR... -
Lentivirus Plasmids
TypeCollection...Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection...coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... more variants. Tyler Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can...pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor expression...silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor expression...17618 for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive...additional variants. Eric Campeau 39481 pLenti-puro 3rd CMV-driven expression of cDNA with puromycin selection... -
MXS Chaining
TypeBlog Post...structures (Table 1). Each construct was flanked with a CMV promoter (to drive high-level expression) and a polyA... -
Plasmids 101: Gateway Cloning
TypeBlog Post...lentiviral expression, we could use a vector like pLenti CMV Puro DEST (w118-1) or the doxycycline-inducible pLIX... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/TO Zeo DEST...genome pAdTrack-CMV - Shuttle vector for transgene expression under a CMV ...pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter...Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient expression - Gradia...expression, Ligation Independent Cloning (LIC) pAG CMV Empty Puro - Empty mammalian expression plasmid for...Plasmids and Resources collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids... promoter, GFP-Zeo pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination... -
Retrovirus Plasmids
TypeCollection...resistance. William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A ...fusion in mammalian cells. Floris Foijer 47916 pRXTN CMV/MSV A modified version of pRX-tight Puro encoding... with IRES-mCherry. Dario Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA. Expresses ...plasmids in this toolkit. Scott Lowe 64865 pLncEXP CMV/MSV lncRNA expression plasmid. Lei Sun 60683 pLXIN-Luc...MoMLV gag , pol , and env . Inder Verma 35614 pBS-CMV-gagpol Contains MoMLV gag and pol . Patrick Salmon...for the FELIX (FIV-based) system. Garry Nolan 8454 pCMV-VSV-G VSV-G envelope protein. Use with packaging... -
Tetracycline Inducible Expression
TypeCollection...Alexeyev 17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV promoter TetR ...contains a TRE between two minimal CMV promoters. None Pbi (TRE, miniCMV) Bert Vogelstein Return to Top Transactivators...features seven copies of tet O upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters...placing seven copies of tet O upstream of the minimal CMV promoter. In the absence of tetracycline, tTA binds...Plasmid Description Transactivator PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral Tet-On vector with...-Tet3G blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON...Jaenisch 25434 pMA2640 Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced... -
Control AAV Preps
TypeCollection...105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 James M. Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV...Constitutive rg* Loren Looger 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10...*, PHP.eB James M. Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 James ...CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other... -
Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior
TypeBlog Post...Brainbow was also used in zebrafish by injecting a CMV-Brainbow construct at the embryonic stage. This technique... -
AAV Molecular Tools
TypeCollection...Activity Serotype PI 61592 pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of...tag). 8 Jonathan Long 160857 pAAV-FLEx-ER-TurboID CMV-driven, Cre-dependent Cre-dependent expression of... -
Plasmids 101: Repressible Promoters
TypeBlog Post...produced. Many commonly-used promoters, such as T7, CMV, EF1A, and SV40, are always active and thus referred... -
Recombinases AAV Preps
TypeCollection...105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 James M. Wilson 105545 pAAV.CMV.HI.eGFP-Cre....pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 James M. Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not ... -
Quick Guide to All Things Lentivirus
TypeBlog Post...5’LTR has been deleted to reduce its activity. A CMV or an EF1α promoter has been inserted in this LTR... -
Sequencing Primers
TypeGuide...growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward...chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE...promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA 3' end...same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-... -
Lentiviral Prep Service
TypeCollection...17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter,... -
Fluorescent Proteins: FRET
TypeCollection...72,000 0.22 5.3 1.9 mEGFP-N1 , mCherry2-N1 , pcDNA3.1 CMV mCherry-eGFP BGH Clover mRuby2 505 0.76 600 113,000...** 488 0.6 531** 136,000 0.01 6.1 4.5 mEGFP-N1 , CMV-ShadowY , EGFP-ShadowY λ Dex : Donor maximum excitation...128,000 0.45 6.4 4.9 pNCS-mClover3 , pNCS-mRuby3 , pKanCMV-mClover3-mRuby3 mNeonGreen mRuby3 506 0.80 592 ... -
Zhang Lab CRISPR Page
TypeCollection...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...