Skip to main content

We narrowed to 67 results for: cmv

Showing: 21 - 40 of 67 results
  1. Luciferase Plasmid Collection

    Type
    Collection
    ...luciferase Eric Campeau 21474 pLenti CMV V5-LUC Blast (w567-1) Firefly CMV Lentiviral expression of firefly...Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai 87121 pcDNA-RLuc8 Renilla CMV Mammalian... luciferase Ming-Chih Lai 100984 pGL4.18 CMV-Luc Firefly CMV Mammalian expression of firefly luciferase... Cypridina EF1α, CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina luciferase...William Hahn, David Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase...firefly luciferase Mark Kay 105532 pAAV.CMV.ffLuciferase.SV40 Firefly CMV AAV expression of firefly luciferase...Venus-firefly luciferase Roland Friedel 170575 pCMV-FLuc Firefly CMV Retroviral expression of firefly luciferase...
  2. Lentivirus Plasmids

    Type
    Collection
    ...Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection...coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... more variants. Tyler Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can...pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor expression...silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor expression...17618 for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive...additional variants. Eric Campeau 39481 pLenti-puro 3rd CMV-driven expression of cDNA with puromycin selection...
  3. MXS Chaining

    Type
    Blog Post
    ...structures (Table 1). Each construct was flanked with a CMV promoter (to drive high-level expression) and a polyA...
  4. Plasmids 101: Gateway Cloning

    Type
    Blog Post
    ...lentiviral expression, we could use a vector like pLenti CMV Puro DEST (w118-1) or the doxycycline-inducible pLIX...
  5. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/TO Zeo DEST...genome pAdTrack-CMV - Shuttle vector for transgene expression under a CMV ...pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter...Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG, Ubc Transient expression - Gradia...expression, Ligation Independent Cloning (LIC) pAG CMV Empty Puro - Empty mammalian expression plasmid for...Plasmids and Resources collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids... promoter, GFP-Zeo pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination...
  6. Retrovirus Plasmids

    Type
    Collection
    ...resistance. William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A ...fusion in mammalian cells. Floris Foijer 47916 pRXTN CMV/MSV A modified version of pRX-tight Puro encoding... with IRES-mCherry. Dario Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA. Expresses ...plasmids in this toolkit. Scott Lowe 64865 pLncEXP CMV/MSV lncRNA expression plasmid. Lei Sun 60683 pLXIN-Luc...MoMLV gag , pol , and env . Inder Verma 35614 pBS-CMV-gagpol Contains MoMLV gag and pol . Patrick Salmon...for the FELIX (FIV-based) system. Garry Nolan 8454 pCMV-VSV-G VSV-G envelope protein. Use with packaging...
  7. Tetracycline Inducible Expression

    Type
    Collection
    ...Alexeyev 17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV promoter TetR ...contains a TRE between two minimal CMV promoters. None Pbi (TRE, miniCMV) Bert Vogelstein Return to Top Transactivators...features seven copies of tet O upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters...placing seven copies of tet O upstream of the minimal CMV promoter. In the absence of tetracycline, tTA binds...Plasmid Description Transactivator PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral Tet-On vector with...-Tet3G blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON...Jaenisch 25434 pMA2640 Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced...
  8. Control AAV Preps

    Type
    Collection
    ...105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 James M. Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV...Constitutive rg* Loren Looger 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10...*, PHP.eB James M. Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 James ...CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other...
  9. AAV Molecular Tools

    Type
    Collection
    ...Activity Serotype PI 61592 pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of...tag). 8 Jonathan Long 160857 pAAV-FLEx-ER-TurboID CMV-driven, Cre-dependent Cre-dependent expression of...
  10. Recombinases AAV Preps

    Type
    Collection
    ...105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 James M. Wilson 105545 pAAV.CMV.HI.eGFP-Cre....pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 James M. Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not ...
  11. Sequencing Primers

    Type
    Guide
    ...growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward...chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE...promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA 3' end...same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-...
  12. Lentiviral Prep Service

    Type
    Collection
    ...17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter,...
  13. Fluorescent Proteins: FRET

    Type
    Collection
    ...72,000 0.22 5.3 1.9 mEGFP-N1 , mCherry2-N1 , pcDNA3.1 CMV mCherry-eGFP BGH Clover mRuby2 505 0.76 600 113,000...** 488 0.6 531** 136,000 0.01 6.1 4.5 mEGFP-N1 , CMV-ShadowY , EGFP-ShadowY λ Dex : Donor maximum excitation...128,000 0.45 6.4 4.9 pNCS-mClover3 , pNCS-mRuby3 , pKanCMV-mClover3-mRuby3 mNeonGreen mRuby3 506 0.80 592 ...
  14. Zhang Lab CRISPR Page

    Type
    Collection
    ...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...
Showing: 21 - 40 of 67 results