Skip to main content

We narrowed to 4 results for: cmv

Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ...growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward...chloramphenicol resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE...promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA 3' end...same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE) Forward pMT2-...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation...fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between... LTRs and replaced with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter...hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started..., including: Lymphocytic Choriomeningitis Virus (LCMV) – less toxic and inflammatory; targets wide range...
  3. Promoters

    Type
    Guide
    ...promoter; contains CMV early enhancer element and the chicken beta-actin promoter CMV Constitutive Mammalian...
  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...and replaced with a heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter...hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription started...
Showing: 1 - 4 of 4 results