Skip to main content

We narrowed to 48 results for: cmv promoter

Showing: 21 - 40 of 48 results
  1. Multicolor Animals: Using Fluorescent Proteins to Understand Single Cell Behavior

    Type
    Blog Post
    ...tandem with a single promoter, but only the gene directly following the promoter is expressed. Cre-mediated... As RFP and OFP are directly downstream of the promoter in Brainbow 1.0 and 1.1, respectively, cells will...Brainbow system are that it does not use ubiquitous promoters, meaning that not all cell types can be labeled...Brainbow was also used in zebrafish by injecting a CMV-Brainbow construct at the embryonic stage. This technique...placing Brainbow downstream of a neural-specific promoter, or the entire fish could be labeled by injecting...an RFP, CFP, and YFP downstream of a ubiquitous promoter. Zebrabow is an extremely versatile technology...
  2. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...from the CMV promoter pAdx-CMV-YFP 73348 Express YFP with an NLS from the CMV promoter pAdx-CMV-dsRed 73349...gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV promoter pCDH-EF1 72266...from the CMV promoter pAdx-CMV-iCre-p2A-copGFP 73350 Expresses iCre and EGFP from the CMV promoter pAdx-CMV-iCre-P2A-tdTomato...EF1 promoter while pICPIS-CB contains the Chicken-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ...Xgal/IPTG plate pAdx-CMV-copGFP 73346 Expresses copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses...phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express gene of interest from the CMV promoter. WPRE has been ...truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro 73037 Expresses Nluc and copGFP from the CMV promoter...
  3. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...and the promoter of the 5’LTR has been deleted to reduce its activity. A CMV or an EF1α promoter has been...the control of two different promoters. Both the single and dual promoter transfer vectors can be used...containing the rev response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid...entry site (IRES) and expressed under the same promoter. Alternatively, your gene and the marker can be...cell cycle, a transfer vector with an inducible promoter (see below) should be used. Inducible lentiviral...Tet-response element (TRE) is placed upstream of the promoter in your transfer vector. In the absence of tetracycline...
  4. Luciferase Plasmid Collection

    Type
    Collection
    ...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...fusions. Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin ...plants. Renilla luciferase under the control of a CMV promoter is present for normalization. Alejandro Ferrando...luciferase Eric Campeau 21474 pLenti CMV V5-LUC Blast (w567-1) Firefly CMV Lentiviral expression of firefly...Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai 87121 pcDNA-RLuc8 Renilla CMV Mammalian... luciferase Ming-Chih Lai 100984 pGL4.18 CMV-Luc Firefly CMV Mammalian expression of firefly luciferase... Cypridina EF1α, CMV Dual secreted luciferase reporter (EF1α-Gaussia luciferase, CMV-Cypridina luciferase...
  5. Adenovirus Plasmids

    Type
    Collection
    ...viruses containing transgene under CMV promoter Vogelstein 50957 RedTrackCMV For production of mRFP-trackable...containing transgene under a chosen promoter Vogelstein 16403 pShuttle-CMV For production of viruses containing...containing transgene under CMV promoter Vogelstein 16404 pAdTrack For production of GFP-trackable viruses...containing transgene under a chosen promoter Vogelstein 16405 pAdTrack-CMV For production of GFP-trackable...under Neuron-specific enolase (NSE) promoter Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus For production of viruses...transgene under mouse cofilin promoter (MCP) Bamburg 62622 pShuttle-CMV-F2A-T2A For production of viruses...mRFP-trackable viruses containing transgene under CMV Bamburg 16407 pAdEasy 2-GFP beta-gal Test plasmid that contains...
  6. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/TO Zeo DEST...genome pAdTrack-CMV - Shuttle vector for transgene expression under a CMV ...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination vector, expression, CMV/TO promoter... promoter, GFP-Zeo pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral Gateway destination...
  7. Lentivirus Plasmids

    Type
    Collection
    ... Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin selection...coexpression. Didier Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included to monitor... more variants. Tyler Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can...shRNA under the control of a tet-responsive H1 promoter. Didier Trono 11651 pLVUT-tTR-KRAB 3rd Inducible...with a chimeric 5’LTR. Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...
  8. Tetracycline Inducible Expression

    Type
    Collection
    ... upstream of a minimal CMV promoter, and other tet- or dox-dependent promoters (sometimes generally called...17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV promoter TetR Eric ...contains a TRE between two minimal CMV promoters. None Pbi (TRE, miniCMV) Bert Vogelstein Return to Top Transactivators...seven copies of tet O upstream of the minimal CMV promoter. In the absence of tetracycline, tTA binds to...transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter, and type ...pLVX-Tet3G blasticidin Lentiviral Tet-On vector with CMV promoter Tet-On 3G rtTA Oskar Laur 96963 pCAG-TetON-3G...from UbC promoter rtTA-Advanced Rudolf Jaenisch 25434 pMA2640 Retroviral Tet-On vector for CMV-driven rtTA...
  9. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0-sNRPpA AAV 74306 pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpA...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...
  10. AAV Molecular Tools

    Type
    Collection
    ...Activity Serotype PI 61592 pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off...tag). 8 Jonathan Long 160857 pAAV-FLEx-ER-TurboID CMV-driven, Cre-dependent Cre-dependent expression of...adeno-associated virus to express GFE3 under the EF1a promoter in a 'Cre-on' dependent manner. 1 Don Arnold 169128... with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev 200778 AAV-∆Hapln1 hSyn-... with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev 203840 pAAV-hSyn-Kir2.1WT...
  11. Control AAV Preps

    Type
    Collection
    ...-B10 CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin...105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 James M. Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV...Constitutive rg* Loren Looger 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10...*, PHP.eB James M. Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 James ...that express fluorescent proteins under general promoters. These AAV can be used to compare the activity...Constitutive (non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP...
  12. Recombinases AAV Preps

    Type
    Collection
    ...105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 James M. Wilson 105545 pAAV.CMV.HI.eGFP-Cre....information about these molecular tools. Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 James M. Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not ...AAV.TBG.PI.Cre.rBGe TBG none 8 James M. Wilson Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)... Syn none 5, rg* Hongkui Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...Research Program Light-Inducible Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV...EF1a none 1, PHPeB Hongkui Zeng VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre...
  13. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...hATMS1981A ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 32813 CMV-hEAAT1 SLC1A3 CMV Episodic ataxia ...DsRed-p150 217-548 DCTN1 CMV ALS, motor neuron disease Trina Schroer 51221 CMV-CC2 DCTN1 CMV ALS, motor neuron...51412 CMV-p150 DCTN1 CMV ALS, motor neuron disease Trina Schroer 51435 pGL3Basic_ME.1/ApoEpromoter APOE...moPrP(3F4) D177N PRNP CMV Dementia Susan Lindquist 1321 cytosolic moPrP (3F4) PRNP CMV Dementia Susan Lindquist...FLAG-hPLIC-2 UBQLN2 Flag CMV ALS Peter Howley 8662 p4456 FLAG-hPLIC-2 NTF UBQLN2 Flag CMV ALS Peter Howley 10880...DNMT1 GFP CMV Hereditary sensory neuropathy type IE Tyler Jacks 12166 pSicoR Dnmt1 DNMT1 GFP CMV Hereditary...
  14. Lentiviral Prep Service

    Type
    Collection
    ...pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro...Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Zhang Cas9 and Accessories...
  15. Zhang Lab CRISPR Page

    Type
    Collection
    ... sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be digested...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...
  16. Sequencing Primers

    Type
    Guide
    ...terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC Human CMV promoter Forward Luc-F AGTCAAGTAACAACCGCGA...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG...
  17. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    ...customizable sgRNA from the U6 promoter and puromycin resistance from the EF-1a promoter. It’s a 3rd generation.... Find pSpCas9(BB)-2A-Puro (PX459) V2.0. pCMV-VSV-G - pCMV-VSV-G was deposited by the Bob Weinberg lab.... It can be used with packaging plasmids such as pCMV-dR8.2 dvpr (lentiviral) or pUMVC (MuLV retroviral..., this plasmid predates Addgene’s founding. Find pCMV-VSV-G. pRSV-Rev - This 3rd generation lentiviral...
  18. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...10878/ . Description Vector Element U6 Human U6 promoter drives RNA Polymerase III transcription for generation...transduced cells. hPGK Human phosphoglycerate kinase promoter drives expression of puromycin. Puro R Puromycin...be used with packaging plasmid pCMV-dR8.2 dvpr and envelope plasmid pCMV-VSVG from Robert Weinberg’s lab...Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG from the Robert Weinberg lab. For...
Showing: 21 - 40 of 48 results