We narrowed to 44 results for: cmv promoter

...components, such as your CRISPR enzyme or Pol 2 promoter. The options available in each class, or module...out reporters, Cas proteins, guide cassettes, promoters, N’ and/or C’ terminus, and selection markers....lentiGuide-based) Mammalian Lentivirus pRDA_722 (CMV-driven; lentiCRISPRv2-based; preferred over 512) ...) Mammalian Lentivirus pRDA_789 (CMV-driven; CROPseq) Mammalian AAV pRDA_889 (ITRs from...

...pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro...Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Feng Zhang Cas9 and Accessories...

...vector containing a promoter for constitutive (CMV, SV40, SFFV) or inducible (CMV-TO) cDNA expression,...fluorescent proteins, 8 constitutive promoters, 2 includible promoters, 3 polyA terminators and various pieces...sequences. Several pre-constructed promoter-selection marker or promoter-inducible expression related vectors...plasmids: Luc (intronless; CMV-LUC2CP/ARE and Luc-I (intron-containing; CMV-LUC2CP/intron/ARE). The Luc-I...all chemically inducible promoters; 3) improving the strength of the promoters used; and 4) optimizing ...ideal promoter/location combination. However, other constructs which contain different promoters and/or...to study the human GM-CSF promoter and enhancer, a finely regulated promoter controlled by a mixture of...

...designed for mammalian expression utilize viral promoters (SV40, CMV, and RSV) for robust expression post-transfection...the use of constitutive and inducible promoters. Inducible promoters are extremely useful if a desired protein... of the galactose inducible promoter (GAL). Other commonly used promoters include the phosphate and copper... Blog Learn about inducible promoters Learn about repressible promoters Check out protein tags Resources... of these vectors is controlled by a different promoter resulting in different levels of expression from... vectors, pET, under the control of the T7 lac promoter and induced by lactose, provides the highest level...copper inducible PHO5 and CUP1 promoters respectively. Yeast cells are grown in well-defined media and...

...expression plasmids in a high copy backbone with a T7 promoter driving multiple combinations of WT, codon optimized...which drive expression using either TEF1 or GAL1 promoters. These vectors are intended for the high level...versions of SARS-CoV-2 S (spike protein) cloned into a CMV driven expression vector are also available. These...

...the CAG promoter, a hybrid promoter consisting of a CMV enhancer, chicken beta actin promoter, and rabbit... tags and fusion proteins Finally, we confirm promoters, tags, fusion proteins, and selectable markers...

...plasmids have a chimeric 5'LTR that includes a CMV or RSV promoter as well as a portion of the 5'LTR. Including...majority of transfer plasmids use the weak viral LTR promoter to drive expression of the gene of interest. Consequently...2nd-generation system because the wildtype 5'LTR promoter requires Tat to function. Third-generation plasmids...

...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; contains CMV early ...and the chicken beta-actin promoter CMV Constitutive Mammalian Strong promoter from human cytomegalovirus...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences...

... cells where common eukaryotic promoters (such as CMV or EF1A promoters found in many CRISPR plasmids)...transfection or viral transduction     Appropriate promoters must be chosen for both Cas9 and gRNA expression...

...tandem with a single promoter, but only the gene directly following the promoter is expressed. Cre-mediated... As RFP and OFP are directly downstream of the promoter in Brainbow 1.0 and 1.1, respectively, cells will...Brainbow system are that it does not use ubiquitous promoters, meaning that not all cell types can be labeled...Brainbow was also used in zebrafish by injecting a CMV-Brainbow construct at the embryonic stage. This technique...placing Brainbow downstream of a neural-specific promoter, or the entire fish could be labeled by injecting...an RFP, CFP, and YFP downstream of a ubiquitous promoter. Zebrabow is an extremely versatile technology...

...and the promoter of the 5’LTR has been deleted to reduce its activity. A CMV or an EF1α promoter has been...the control of two different promoters. Both the single and dual promoter transfer vectors can be used...containing the rev response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid...entry site (IRES) and expressed under the same promoter. Alternatively, your gene and the marker can be...cell cycle, a transfer vector with an inducible promoter (see below) should be used. Inducible lentiviral...Tet-response element (TRE) is placed upstream of the promoter in your transfer vector. In the absence of tetracycline...

...hUbC-dCas9-T2A-GFP for removable dCas9 expression and pLM-CMV-R-Cre. Selection for cells stably and highly expressing...functional role of DNA demethylation at specific promoters by targeted steric blockage of DNA methyltransferase...

...terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward EGFP-C CATGGTCCTGCTGGAGTTCGTG...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...resistance gene Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human CMV immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse...

... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0-sNRPpA AAV 74306 pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpA...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...

...-B10 CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin...pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10, PHP.eB James M. Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ...that express fluorescent proteins under general promoters. These AAV can be used to compare the activity...Constitutive (non-cre-dependent) Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP...James M. Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 James M. Wilson 105534...M. Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 James M. Wilson 105549...

...Activity Serotype PI 61592 pX600-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA CMV-driven, constitutive Expression of...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off...adeno-associated virus to express GFE3 under the EF1a promoter in a 'Cre-on' dependent manner. 1 Don Arnold 124364...tag). 8 Jonathan Long 160857 pAAV-FLEx-ER-TurboID CMV-driven, Cre-dependent Cre-dependent expression of... with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev 200778 AAV-∆Hapln1 hSyn-... with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev 203840 pAAV-hSyn-Kir2.1WT...

...pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 James M. Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1,...information about these molecular tools. Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...AAV.TBG.PI.Cre.rBGe TBG none 8 James M. Wilson Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)... Syn none 5, rg* Hongkui Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...Research Program Light-Inducible Recombinases ID Name Promoter Fluorophore Serotype(s) PI 140135 pAAV-EF1a-iCreV...EF1a none 1, PHPeB Hongkui Zeng VCre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI 55638 pAAV-EF1a-vCre...

...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...hATMS1981A ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 32813 CMV-hEAAT1 SLC1A3 CMV Episodic ataxia ...DsRed-p150 217-548 DCTN1 CMV ALS, motor neuron disease Trina Schroer 51221 CMV-CC2 DCTN1 CMV ALS, motor neuron...moPrP(3F4) D177N PRNP CMV Dementia Susan Lindquist 1321 cytosolic moPrP (3F4) PRNP CMV Dementia Susan Lindquist...FLAG-hPLIC-2 UBQLN2 Flag CMV ALS Peter Howley 8662 p4456 FLAG-hPLIC-2 NTF UBQLN2 Flag CMV ALS Peter Howley 10880...DNMT1 GFP CMV Hereditary sensory neuropathy type IE Tyler Jacks 12166 pSicoR Dnmt1 DNMT1 GFP CMV Hereditary... N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's Mark...

... sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be digested...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...

...information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin (...of retinal bipolar cells with improved mGluR6 promoters in rodents and primates. Mol Ther . 2016 Aug;23...