Skip to main content

We narrowed to 31 results for: gfp retroviral vector

Showing: 21 - 31 of 31 results
  1. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They... interest and cloned into provided destination vectors using low-cost, one-pot golden gate cloning that... Jacks Lab constructed several GMAP-compatible vectors for a wide variety of biological applications. ...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ...
  2. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression (this is a bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression...Mammalian Retroviral Expression mCherry 587 610 16 4.5 15 min Monomer pcDNA3 mCherry LIC cloning vector (6B)...Mammalian Gateway Destination Vector pENTR4-HaloTag (w876-1) - Gateway Entry Vector pCS2+/C-Halo , pCS2+/N-Halo...Gateway Entry Vector pCS2+/C-SNAPf , pCS2+/N-SNAPf - Xenopus Expression pSNAP-tag (T7) Vector - Bacterial...pCLIP-tag (m) Vector - Mammalian Expression pENTR4-CLIPf (w877-2) - Gateway Entry Vector pET51b-His-TEV-CLIP-tag...Mammalian Expression sfGFP (superfolder GFP) 485 507 54 14 min Prone to dimerization sfGFP-N1 - Mammalian Expression...Expression EGFP 488 507 34 6 25 min Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Viral Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors...Gamma-retroviral vector packaging methods. Viral Vector Integration Much like lentiviral vectors, gamma-retroviral...gamma-retroviral vectors integrate at random locations throughout the genome. Gamma-retroviral vectors tend...Common Uses of Gamma-Retroviral Vectors Due to their integration, gamma-retroviral vectors are useful research... gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors...popular application of gamma-retroviral vectors. Gamma-retroviral vectors have been shown to be safe delivery...Addgene's lentiviral vector guide . Gamma-Retroviral Vectors The genome of gamma-retroviruses ranges from 9–...
  4. Sequencing Primers

    Type
    Guide
    ...inserts in pBMN retroviral vector MMLV sequence, for inserts in pBMN retroviral vector Forward pBR322ori-F...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC... 5' of MCS in pBABE vectors Forward pBAD Forward ATGCCATAGCATTTTTATCC For vectors with E. coli araBAD ...For pBluescript vector Forward pBluescript SK TCTAGAACTAGTGGATC For pBluescript vector Reverse pGEX 3'...For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1...Pichia vectors with AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1...pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC SV40 enhancer, 3' of MCS in pBABE vectors Reverse...
  5. Lentivirus Plasmids

    Type
    Collection
    ...engineered into viral vectors for safe use in the lab. One safety feature of lentiviral vectors is that the components...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA...Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin...plasmids available at Addgene. Read our Lentiviral Vector Guide for more information about lentiviral components... viral production, and viral safety. Lentiviral Vector Guide Popular Lentiviral Transfer Plasmids Looking...expression of RFP as a reporter. See plasmid 17618 for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST...
  6. Lentiviral Vector Guide

    Type
    Guide
    ...Guides Viral Vectors Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral...Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically ranges from...’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Viral Vector Integration... Answered The Retroviral Lifecycle More Viral Vectors 101 topics More Lentiviral Vector topics Addgene...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...
  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca 2+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP...
  8. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  9. Molecular Biology Reference

    Type
    Guide
    ...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. Empty Backbones , ...another, such as from a chromosome to a plasmid or vector DNA backbone. These tools are essential to the ...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...usually for the purposes of gene study. Expression vectors must contain a promoter sequence, a transcription... sequence, and the inserted gene. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...
  10. CRISPR Guide

    Type
    Collection
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...
  11. CRISPR Guide

    Type
    Guide
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...
Showing: 21 - 31 of 31 results