Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 33 results for: gfp retroviral vector

Showing: 21 - 33 of 33 results

  1. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector for your... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These systems...single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one vector, and plasmids...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...-T2A-Cas9 75348 Mammalian/Retroviral from pXL yes, activate S. pyogenes EGFP Luikart pRubiC-T2A-Cas9 75347...

  2. CRISPR References and Information

    Type
    Collection
    ...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2...CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles ...positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR...Addgene Church gRNA design and cloning gRNA cloning vector PDF, 118 KB Church gRNA design and cloning for ...at Addgene Parrott NEBuilder Assembly of CRISPR vectors using ssDNA oligos p201G Cas9 ; p201B Cas9 ; p201H...lentiCRISPR v2 2 vector system: lentiCas9-Blast and lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive...positive control: CMV-EGFP Pooled libraries are also available for human and mice PDF, 276 KB Content last...

  3. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Bacterial Vectors - Includes tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial...bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression SGFP2 495 512 ...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian...then scientists have engineered numerous GFP-variants and non-GFP proteins that result in a diverse set ...Mammalian Retroviral Expression mCherry 587 610 16 4.5 15 min Monomer pcDNA3 mCherry LIC cloning vector (6B)...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...

  4. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors Vector Production...Common Uses of Gamma-Retroviral Vectors Due to their integration, gamma-retroviral vectors are useful research... gamma-retroviral vectors is essentially the same as lentiviral vectors. Many gamma-retroviral vectors...popular application of gamma-retroviral vectors. Gamma-retroviral vectors have been shown to be safe delivery...Addgene's lentiviral vector guide . Gamma-Retroviral Vectors The genome of gamma-retroviruses ranges from 9–...Read our gamma-retroviral guide to learn about gamma-retroviral components, retroviral production, and... Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For...

  5. Adenovirus Plasmids

    Type
    Collection
    ... in E3 and insertion of GFP expression cassette. Bunz 179202 pAd5-B6/7 ∆E3-GFP Adenoviral A block for ...regions present in pAd5-B6 ∆E3-GFP and pAd5-B7 . Bunz 179203 pAd5-B1-deltaE1-GFP Adenoviral A block for the...production of GFP-trackable viruses containing transgene under CMV promoter Vogelstein 16407 pAdEasy 2-GFP beta-gal...Collection of adenovirus shuttle vectors and strains Viral...Biosafety Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook Adenoviruses are a class of medium-sized...with large inserts Vogelstein 179201 pAd5-B6 ∆E3-GFP Adenoviral A block for the AdenoBuilder genome assembly...system. Block 1 with deletion in E1 and insertion of GFP expression cassette. Bunz 16402 pShuttle Shuttle ...

  6. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...Douglas Kim , GENIE Project Calcium Bicistronic vector expressing GCaMP6 and mRuby2 for imaging neural... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...

  7. Lentiviral Vector Guide

    Type
    Guide
    ...Lentiviral Vector Guide Lentiviral Vector Guide Jump To: Lentiviral Vectors Lentiviral Generations Vector Production...Addgene's gamma-retroviral vector guide . Lentiviral Vectors The genome of lentiviruses typically ranges from... Answered The Retroviral Lifecycle More Viral Vectors 101 topics More Lentiviral Vector topics Addgene...lentiviral vectors that can be safely used in laboratory settings. These engineered lentiviral vectors have ...contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need a..., see Addgene’s viral vector protocols . Figure 5: Overview of lentiviral vector production. Created with...Lentiviral Vectors Due to their integration and long-term expression of a transgene, lentiviral vectors are ...

  8. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer...

  9. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...

  10. Lentivirus Plasmids

    Type
    Collection
    ...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...Kasparov 1732 pCPRDEnv 2nd Packaging part of the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid... Transfer Plasmids Lentiviruses, a subset of retroviruses, are some of the most common and useful types...

  11. Molecular Biology Reference

    Type
    Guide
    ...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription...the transcription process to stop. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

  12. CRISPR Guide

    Type
    Collection
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

  13. CRISPR Guide

    Type
    Guide
    ...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...
Showing: 21 - 33 of 33 results