... been deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and... transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming somatic...instance, inserting PhoCl in between a protein and a tag, such as an NLS or NES, enables control over localization...gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression...smooth endoplasmic reticulum (OSER) assay. A major advantage of mCyRFP1 is its ability to be coexcited along... used a combination of deliberate and random mutagenesis to isolate the best RFP. They targeted known ...

...is to tag the protein of interest with a small biochemical “epitope tag” such that these tagged proteins... the tagging efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) ...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if...endogenous gene tagging in human cells Plasmids 101: Protein Tags Fluorescent tagging of endogenous genes...each with a different tagged protein of interest, and a universal all-purpose “tag antibody” can be used...projects that require epitope tagging of a large cohort of genes (e.g. tagging genes representing a protein...pipeline for epitope tagging. Using our 96-format pipeline, we can routinely achieve 5-30% tag knock-in efficiency...

...-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling...Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-...endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson...pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-Rab5 WT Early endosomes RAB5A DsRed2...Plasmids encoding fluorescent proteins tagged with genes or peptides with known subcellular localization... NLS mKalama1 Robert Campbell 73205 pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3 Nucleus NLS (from Mak16p protein)...

...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...ataxia Ronald Kahn 11443 pBS human Frataxin (myc tag) FXN Myc T7 Friedreich ataxia Ronald Kahn 11487 pET32a-HD16Q...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...

... mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5)...pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Resources Read Addgene's Blog...

...dedifferentiation stage involves overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that...More (due to additional pluripotency stage) Less Safety Less (C-MYC, a known oncogene is one of the reprogramming...lineage, without dedifferentiating into a pluripotent stage. Cellular reprogramming The reversal of a differentiated...reprogramming [1]. The process can be divided into two stages: Dedifferentiation - Conversion of adult somatic...differentiated somatic cell to revert back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate...reprogrammed to iPSCs successfully [10-12]. The next stage of reprogramming consists of redifferentiation of...

...promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...

...NanoLuc® with either SNAP‐tag or HaloTag7 tag in which labeling of the self‐labeling tag with a fluorophore ...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (neo...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...and Renilla luciferase are less-than-ideal protein tags due to their large size. NanoLuc® Luciferase is ...biosensor that utilizes Renilla luciferase and a Halo tag to assay mRNA decay in real time. pKC-4.04, pKC-4.06...Lentiviral expression of firefly luciferase with a V5 tag Kevin Janes 83281 pAAV-CAG-FLuc Firefly CAG AAV expression...including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen ...

...collections: Tags and Other Markers : Antibodies targeting popular markers like tubulin or epitope tags like ...like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins for neuroscience research. Institute...

...epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular tag, the IT6... for epitope tagging: Inntags When fused to your protein of interest (POI), epitope tags give you the...production of a new series of epitope tags, inntags (innocuous tags), that they believe will have fewer ...expressed either without a tag or as multiple fusions with different N- and C-terminal tags. Additionally, by ...Unfortunately, while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause ...expression of fusions between the POI and a TAP tag (a tag with two epitopes that can be used to sequentially...the POI-tag fusion from a plasmid or from a random genomic location than to express the tagged protein...

...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...therapeutic purposes. Both types have their advantages and disadvantages. Here is a table listing some of them... system which combined the advantages of both while limiting disadvantages led to the creation of induced...cells found in the zygote through to the morula stage are totipotent [2-4]. Pluripotency: When a cell ... Induced Pluripotent Stem Cells: Problems and Advantages when Applying them in Regenerative Medicine. ...

... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review...retreat to the woods for months at a time, so take advantage of whatever time you have. If you’re like me, ...

...Knock-in tagging - Michel Bagnat lab. Targeting cassettes encoding fluorescent proteins for tagging genes...bearing either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9...rapidly model potential cancer drivers in vivo. Biotagging toolkit - Tatjana Sauka-Spengler Lab. A genetic...

... Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...

...Roux lab has deposited HA tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions...for an individual tagging event. Commonly used sequences, including fluorescent tags, a floxed Cbr-unc...proteins are tagged with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly ...technology. To streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen...119 selectable marker, and “connectors” that link tags to the targeted gene are supplied to the reaction...editing in worms to the point that high-throughput tagging projects can be performed. Schwartz, et al. Genetics...lentiviral transfer vector. Each gene has been FLAG-tagged for convenient experimental use. The plasmids were...

...Epitope tag antibody collection grows By Ashley Waldron We are excited to highlight the Anti-V5 tag antibody... as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile option for tagging proteins...immunodeficiency virus p27 using tag-specific monoclonal antibody and tag-linked antigen. J Gen Virol., ...Figure 3: Expression of fluorophore-tagged GOLG-4 through eight stages of embryonic development. Representative...find in this post: Anti-V5 and other new epitope tag antibodies from IPI New tool for structural studies...studies of E3 ligase cereblon Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene...Innovation (IPI), part of a new collection of epitope tag antibodies available through Addgene. Anti-V5 [IPI-SV5...

... a unique tag into a genomic site of choice via the mutational abilities of PolI3m. This tag would allow...result in a spectinomycin resistant phenotype in bacteria. While there are many known spectinomycin resistance... for mutagenesis, a feature which they used to generate bacteria resistant to both spectinomycin and streptomycin...directed mutagenesis to generate specific mutations in your plasmids Use REPLACER Mutagenesis to mutate...Mutagenesis is a tool that both evolution and molecular biologists use to tinker with DNA. Making changes...region. EvolvR, a CRISPR-Cas9 based targeted mutagenesis method developed by the Dueber Lab at Berkeley...potential applications. Challenges of existing mutagenesis methods Several continuous diversification methods...

...protein tags can be used to facilitate the visualization of specific proteins in cells. Tagged protein...containing AHA to a fluorescent alkyne tag. The newly synthesized and tagged proteins can then be observed with...the knock-in of fluorescent tags into the gene locus of interest. An advantage of this alternative is the...here, there is the question of whether or not the tags influence behavior. A conference and a breakthrough... known as fluorescence noncanonical amino acid tagging (FUNCAT, Dieterich et al. Nature Neuroscience, ...protein of interest that also had incorporated the AHA tag after pulse labeling of a determined period of time...used for cell labeling Check out other protein tagging strategies Additional Resources on Addgene.org...

... SpCas9 is also fused to a 3X FLAG tag at its N-terminus. This tag can be used to test for SpCas9 expression...Alternative forms of this vector contain GFP-tagged and un-tagged versions of SpCas9 and further variants ...SpCas9 is fused to the puromycin resistance gene through a 2A peptide. The puromycin resistance gene enables...causes the ribosome to translate Cas9-2A and the Puromycin resistance gene as separate peptides. PX459 This...predecessor, which had a point mutation in the puromycin resistance gene that made it less effective in...

...expression ~ ~ ~ ~ ✓   ✓ SV40 and c-Myc nuclear localization sequences Improve translocation...ones in Addgene’s repository later in the post. Advantages of prime editing Less constrained by PAM sequence...