Skip to main content

We narrowed to 105 results for: myc tag

Showing: 21 - 40 of 105 results
  1. Antibodies 101: Immunoprecipitation

    Type
    Blog Post
    ...such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest on the C- ...appealing, but the disadvantages must be carefully considered before using. For example, the tag may affect the...called a pull-down assay, an antibody against the tag is used to isolate the protein of interest. The wide...interfere with protein interactions of interest. Tagged proteins are typically expressed at much higher...proteins. Data obtained from experiments using a tagged protein may not be translatable to the endogenous...with downstream assays. This is particularly advantageous if the antibody used for IP is derived from ... difference. Magnetic beads are particularly advantageous because they do not require centrifugation between...
  2. All Antibodies

    Type
    Collection
    ...collections: Tags and Other Markers : Antibodies targeting popular markers like tubulin or epitope tags like ...like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins for neuroscience research. Institute...
  3. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ... viral particles that express oncogenes, such as Myc. Viral vectors also have the largest genomic footprint...transgenes is a concern as well, and reactivation of Myc or other oncogenes after differentiation has been...including reporters and RNAi) for:  NANOG  OCT4 SOX2 MYC KLF4 LIN28 Check out these plasmids if you’re interested...Efficient and Stable Genome integration Insertional mutagenesis, transgene reactivation, residual expression ...Efficient and Stable Genome integration Insertional mutagenesis, residual expression piggyBac Excisible Medium...reprogramming efficiencies reported in González et al. A percentage is not listed because many variables (cell type...generating methods due to the risk of insertional mutagenesis. Random integration also creates heterogeneous...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...Patrick Aebischer 11443 pBS human Frataxin (myc tag) FXN Myc T7 Friedreich ataxia Ronald Kahn 11487 pET32a-HD16Q...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...
  5. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ... been deposited with Addgene and include MYC- and FLAG-tagged TZAP constructs (wild-type and truncation...nonoverlapping emission spectra (N- and C-terminal tags for mTagBFP, TagRFPt, EGFP, mVenus, mCerulean3, mKOFP2) and... transcription factors OCT3/4, SOX2, KLF4, and c-MYC is the established model for reprogramming somatic...instance, inserting PhoCl in between a protein and a tag, such as an NLS or NES, enables control over localization...gRNAs used for TZAP gene editing, and a Hi6xs-MBP tagged TZAPznf9-11constructs used for bacterial expression...smooth endoplasmic reticulum (OSER) assay. A major advantage of mCyRFP1 is its ability to be coexcited along... used a combination of deliberate and random mutagenesis to isolate the best RFP. They targeted known ...
  6. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ... cells. Flexible tagging: Choose untagged or add a versatile N- or C-terminal HA tag. Selectable and stable...Key elements (promoter, tag, polyA site) are flanked by unique restriction sites so you can swap sequences...plasmid set, our bacterial plasmid set for expressing tagged proteins, and stay tuned for mammalian expression...known regulators at the FOS gene promoter and the MYC locus (Figure 5). Figure 5: TurboCas protein...streptavidin immunoprecipitation (IP), and tandem mass tag (TMT) mass spectrometry (MS) in HCT116 cells (colorectal...lentiviral supernatant and selected with puromycin. Puromycin-resistant cells were fixed and labeled with... stable: A puromycin resistance gene makes stable cell line creation a breeze. Modular by design: Key ...
  7. Hassle-free 96-well Format Epitope Tagging Using Cas9 Ribonucleoprotein

    Type
    Blog Post
    ...is to tag the protein of interest with a small biochemical “epitope tag” such that these tagged proteins... the tagging efficiency in the transfected cells, we count the number of tag-positive cells (tag ICC) ...crRNA and/or try out an alternative tag (3xFLAG, Myc, V5, or HA). Tag-specific PCR genotyping can tell if...endogenous gene tagging in human cells Plasmids 101: Protein Tags Fluorescent tagging of endogenous genes...each with a different tagged protein of interest, and a universal all-purpose “tag antibody” can be used...projects that require epitope tagging of a large cohort of genes (e.g. tagging genes representing a protein...pipeline for epitope tagging. Using our 96-format pipeline, we can routinely achieve 5-30% tag knock-in efficiency...
  8. AAV Molecular Tools

    Type
    Collection
    ...pAAV-EFS-SpCas9 EFS-driven, constitutive Expression of Myc-tagged SpCas9. 8 Ryohei Yasuda Labeling Tools These ...pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a. 5, rg* Nathaniel Heintz , Alexander...Expression of ER-localized TurboID (with HA and V5 tag). 8 Jonathan Long 160857 pAAV-FLEx-ER-TurboID CMV-driven...expression of ER-localized TurboID (with HA and V5 tag). 8 Jonathan Long Overexpression Tools These AAV ...GfaABC1D-driven, constitutive Expression of mCherry-tagged, plasma membrane-tethered ibARK in astrocytes. ... Flp-dependent Flp-dependent expression of the voltage-gated Na+ channel mNaChBac and (physically separate...
  9. Zebrafish Plasmid Collection

    Type
    Collection
    ...Knock-in tagging - Michel Bagnat lab. Targeting cassettes encoding fluorescent proteins for tagging genes...bearing either amino- or carboxyl-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish...Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9...rapidly model potential cancer drivers in vivo. Biotagging toolkit - Tatjana Sauka-Spengler Lab. A genetic...
  10. Neurodegeneration Research Collection

    Type
    Collection
    ...DNMT1 with a Myc tag. (Li et al. J Biol Chem. 2006) Express human ATM with Flag and His tags. (Canman et.... Express EGFP-tagged wt and mt tau . (Hoover et al. Neuron. 2010) Express EGFP-tagged wt and mt Alpha-synuclein...myelination. (Lam et al. Nat Commun. 2022) Endogenously tag gene variants for Alzheimer's disease and related...subcellular localization studies with GFP, or IP with Flag tag. (Bennett et al. Heliyon. 2020) Use VAP expression...Chemogenetics Plasmids . Find plasmids for endogenous gene tagging in human cells from the Allen Institute for Cell...sporadic, having no prior family history. A small percentage (5–10%) are familial ALS cases having at least...
  11. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...dedifferentiation stage involves overexpression of four reprogramming factors- OCT4, SOX2, KLF4, and C-MYC - that...More (due to additional pluripotency stage) Less Safety Less (C-MYC, a known oncogene is one of the reprogramming...lineage, without dedifferentiating into a pluripotent stage. Cellular reprogramming The reversal of a differentiated...reprogramming [1]. The process can be divided into two stages: Dedifferentiation - Conversion of adult somatic...differentiated somatic cell to revert back to a pluripotent stage (iPSC formation) [2, 3]. The iPSCs then proliferate...reprogrammed to iPSCs successfully [10-12]. The next stage of reprogramming consists of redifferentiation of...
  12. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pTag-RFP-C-h-Rab5a-c-Myc Endosomes (early) Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Endosomes (early...pTag-BFP-C-h-Rab11a-c-Myc Endosomes (recycling) Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Endosomes...Harrison 79806 pTag-RFP-C-h-Rab11a-c-Myc Endosomes (recycling) Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc...) Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Endosomes (recycling) Rab4a TagBFP James Johnson...Corvera 42635 TagRFP-T-EEA1 Endosomes (early) EEA1 TagRFP-T Silvia Corvera 38770 pEF.myc.ER-E2-Crimson Endoplasmic...early) Rab5 TagBFP Gia Voeltz 61802 GFP-Rab5B Endosomes (early) Rab5B AcGFP Gia Voeltz 79802 pTag-RFP-C-h-...Mitochondria Mitochondrial targeting signal (COX4) TagBFP Gia Voeltz 55102 mCherry-Mito-7 Mitochondria Mitochondrial...
  13. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...epitopes tags such as HA and MYC in vivo. The authors found that fusions to one particular tag, the IT6... for epitope tagging: Inntags When fused to your protein of interest (POI), epitope tags give you the...production of a new series of epitope tags, inntags (innocuous tags), that they believe will have fewer ...expressed either without a tag or as multiple fusions with different N- and C-terminal tags. Additionally, by ...Unfortunately, while there are many types of epitope tags (eg. HA, MYC, Flag), they can be deleterious and cause ...expression of fusions between the POI and a TAP tag (a tag with two epitopes that can be used to sequentially...the POI-tag fusion from a plasmid or from a random genomic location than to express the tagged protein...
  14. Starter guide to induced pluripotent stem cells (iPSCs) part 1:  A renaissance in regenerative medicine

    Type
    Blog Post
    ...of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated from mouse fibroblasts...therapeutic purposes. Both types have their advantages and disadvantages. Here is a table listing some of them... system which combined the advantages of both while limiting disadvantages led to the creation of induced...cells found in the zygote through to the morula stage are totipotent [2-4]. Pluripotency: When a cell ... Induced Pluripotent Stem Cells: Problems and Advantages when Applying them in Regenerative Medicine. ...
  15. Bacterial Expression Systems

    Type
    Collection
    ...used tags, cleavage sites, and signal peptides include: Epitope tags: 6xHis, Flag, Strep II, c-Myc, HA,...bacteria with different purification tag combinations, including PelB tags for localization to the periplasm...Protein Expression Protein Expression Epitope Tags Protein Tags Return to top Protein Visualization To determine..., proteins are often expressed alongside epitope tags, which can also later be used for protein detection...removed using protease cleavage sites. Other protein tags and signal peptides are used to enhance protein ...HA, V5, GST Solubility tags: MBP, SUMO, TrxA, Mocr, NusA Cleavage sites: TEV protease, factor Xa, enterokinase...localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene Protein Purification Resources...
  16. How to Write a Scientific Review Article

    Type
    Blog Post
    ... you casually mention “Haery et al., showed that MYC expression was increased…” when discussing the review...retreat to the woods for months at a time, so take advantage of whatever time you have. If you’re like me, ...
  17. Tetracycline Inducible Expression

    Type
    Collection
    ...expression gene of interest fused with 3xFLAG and 2xStrep-tag from TRE3G promoter for Tandem-Affinity Purification...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection. TetR H1-2O2 Dmitri... with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...operator ( tet O, a 19 nucleotide sequence, TCCCTATCAGTGATAGAGA). In normal conditions, the TetR protein ...inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521...
  18. Sequencing Primers

    Type
    Guide
    ...Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin resistance...HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...resistance gene Forward Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene Reverse NOS-F GCGTTCAAAAGTCGCCTAAG...
  19. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Roux lab has deposited HA tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions...for an individual tagging event. Commonly used sequences, including fluorescent tags, a floxed Cbr-unc...proteins are tagged with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly ...technology. To streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen...119 selectable marker, and “connectors” that link tags to the targeted gene are supplied to the reaction...editing in worms to the point that high-throughput tagging projects can be performed. Schwartz, et al. Genetics...lentiviral transfer vector. Each gene has been FLAG-tagged for convenient experimental use. The plasmids were...
  20. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...Epitope tag antibody collection grows By Ashley Waldron We are excited to highlight the Anti-V5 tag antibody... as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile option for tagging proteins...immunodeficiency virus p27 using tag-specific monoclonal antibody and tag-linked antigen. J Gen Virol., ...Figure 3: Expression of fluorophore-tagged GOLG-4 through eight stages of embryonic development. Representative...find in this post: Anti-V5 and other new epitope tag antibodies from IPI New tool for structural studies...studies of E3 ligase cereblon Optimized mScarlet-based tags for live imaging in C. elegans CRISPR/Cas9 for gene...Innovation (IPI), part of a new collection of epitope tag antibodies available through Addgene. Anti-V5 [IPI-SV5...
Showing: 21 - 40 of 105 results