We narrowed to 31 results for: puromycin

...cells where recombination has occurred. Neomycin, puromycin, and hygromycin resistance genes are commonly ...

...YFP, Strep, TEV-V5) with either blasticidin or puromycin selection. Researchers at the Allen Institute ...

... vectors for CROPseq-multi using selection by Puromycin, Zeocin®, or nuclear expression of BFP2.   ...

...transgenesis plasmids with Neomycin selection Puromycin Mammalian pcDNA3.1-(-)-Pur - Eukaryotic expression...lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin Mammalian, Varies pLKO.1 hygro - Lentiviral...

...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG...

... . The following day, cells were treated with puromycin. Colonies were allowed to grow in the presence...

...deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin), which enables selection of a stable...preparation Appropriate antibiotic for selection (e.g. puromycin, blasticidin) Reagent Preparation DMEM Complete...

...EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with custom-cloned ...a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...

...3' end of puromycin resistance gene Forward Puro-R GTGGGCTTGTACTCGGTCAT 5' end of puromycin resistance...

... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...

... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...