We narrowed to 35 results for: puromycin
-
TypeCollection...-pLKO-puro 3rd inducible expression of shRNA; puromycin selection. See plasmid 21916 for Neo selection...19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway plasmid for ...
-
Colony Formation Titering Assay
TypeProtocol... . The following day, cells were treated with puromycin. Colonies were allowed to grow in the presence... -
Tetracycline Inducible Expression
TypeCollection...plasmid for inducible expression of shRNA with puromycin selection. See Plasmid #21916 for neomycin selection...and design of inducible shRNA expression, with puromycin selection. See Plasmid #85973 for blasticidin ...inducible expression; insert with Gateway cloning and puromycin selection rtTA-Advanced Tight TRE David Root 100521... -
Virus Protocol - Generating Stable Cell Lines
TypeProtocol...deliver mammalian antibiotic resistance (e.g., puromycin, blasticidin), which enables selection of a stable...preparation Appropriate antibiotic for selection (e.g. puromycin, blasticidin) Reagent Preparation DMEM Complete... -
CRISPR Plasmids - Drosophila
TypeCollection...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6... -
Retrovirus Plasmids
TypeCollection... For cloning and gene expression; select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...transgenesis plasmids with Neomycin selection Puromycin Mammalian Tet-pLKO-puro - Tet-inducible...lentiviral vector for EGFP fusion; PGK driven puromycin Hygromycin Mammalian, Varies pLKO.1 hygro - Lentiviral... -
CRISPR Plasmids - Prime Edit
TypeCollection...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222 pPBT-PE2-PuroTK-pegRNA_GG... -
CRISPR Pooled gRNA Libraries
TypeCollection...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with custom-cloned ...a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...Addgene plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively, or constructs... -
Sequencing Primers
TypeGuide...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA... -
Gamma-Retroviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...activate, interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your... -
Lentiviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...